HUGE

Gene/Protein Characteristic Table for KIAA0221

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00466
Accession No. :	D86988
Description :	Regulator of nonsense transcripts 1.
HUGO Gene Name :	UPF1 regulator of nonsense transcripts homolog (yeast) (UPF1)
Clone Name :	ha02799 [Vector Info]
Flexi ORF Clone :	pF1KSDA0221
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5311 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1712 bp

Genome contig ID gi42406306f_18703810
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTGTCACCAAATATTAATAAACAGTTTTGACTTC
Flanking genome sequence
(136230 - 136279)
----+----*----+----*----+----*----+----*----+----*
ACACCAAGGTTGGATAAACTGCAGGGGGTGGAGGGTGCTGGGGTTTTGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 18803810 18840038 24 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1151 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09664	100.0	regulator of no...	synthetic construct
Q92900	99.9	Regulator of no...	Homo sapiens
EDL28813	98.2	UPF1 regulator ...	Mus musculus
Q9EPU0	98.5	Regulator of no...	Mus musculus
BAE28409	98.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014525	5.2e-12	29.5	KIAA0625
AB011132	1.9e-07	24.2	KIAA0560
D42046	1.3e-06	29.9	KIAA0083
AB037825	5e-06	32.0	KIAA1404

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006935 501 567 PF04851 Restriction endonuclease

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006935	501	567	PF04851	Restriction endonuclease

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTTTCGGTTTCCCCTTCTTCC
Primer_r	: ACATTGCCTTGGTACAGTGCG
PCR product length	: 208 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1712 bp
Genome contig ID	gi42406306f_18703810
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGTCACCAAATATTAATAAACAGTTTTGACTTC
Flanking genome sequence (136230 - 136279)	----+--------+--------+--------+--------+----* ACACCAAGGTTGGATAAACTGCAGGGGGTGGAGGGTGCTGGGGTTTTGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	18803810	18840038	24	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0221

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information