HUGE

Gene/Protein Characteristic Table for KIAA0560

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence

Product ID :	ORK00096
Accession No. :	AB011132
Description :	Intron-binding protein aquarius.
HUGO Gene Name :	aquarius homolog (mouse) (AQR)
Clone Name :	hj07625 [Vector Info]
Flexi ORF Clone :	pF1KA0560
Source :	Human adult brain
Note :	We replaced hh01648, former representative clones for KIAA0560 with hj07625. (1999/12/25)

Features of the cloned DNA sequence	Description

Length: 5070 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 503 bp

Genome contig ID gi51511731r_32835782
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TATTATTAGCAGTAAGATACAGGTTTCTTCAATCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCAAAGTGGTTACATGCATTTCCTTCTCTCAAATCTTAGAATGCCTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 32935782 33049215 35 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1521 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510286	99.9	aquarius [Pan t...	Pan troglodytes
O60306	100.0	Intron-binding ...	Homo sapiens
BAF84304	99.9	unnamed protein...	Homo sapiens
ABQ66265	99.9	AQR [Homo sapiens].	Homo sapiens
XP_001089350	96.5	similar to aqua...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	9.2e-12	24.2	KIAA0221
AB014525	1.8e-09	21.7	KIAA0625
AB037825	2.1e-07	32.5	KIAA1404

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	503 bp
Genome contig ID	gi51511731r_32835782
PolyA signal sequence (None)	+--------+--------+----*----+---- TATTATTAGCAGTAAGATACAGGTTTCTTCAATCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCAAAGTGGTTACATGCATTTCCTTCTCTCAAATCTTAGAATGCCTTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	32935782	33049215	35	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0560

Features of the cloned DNA sequence

Features of the protein sequence