HUGE |
Gene/Protein Characteristic Table for KIAA0560 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | |
Product ID : | ORK00096 |
---|---|
Accession No. : | AB011132 |
Description : | Intron-binding protein aquarius. |
HUGO Gene Name : | aquarius homolog (mouse) (AQR) |
Clone Name : | hj07625 [Vector Info] |
Flexi ORF Clone : | pF1KA0560
![]() |
Source : | Human adult brain |
Note : | We replaced hh01648, former representative clones for KIAA0560 with hj07625. (1999/12/25) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5070 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 503 bp Genome contig ID gi51511731r_32835782 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TATTATTAGCAGTAAGATACAGGTTTCTTCAATCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCAAAGTGGTTACATGCATTTCCTTCTCTCAAATCTTAGAATGCCTTAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 r 32935782 33049215 35 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1521 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |