HUGE

Gene/Protein Characteristic Table for KIAA0079

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06755
Accession No. :	D38555
Description :	Protein transport protein Sec24C.
HUGO Gene Name :	SEC24 family, member C (S. cerevisiae) (SEC24C)
Clone Name :	ha03543 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4463 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1064 bp

Genome contig ID gi89161187f_75076395
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TTTAATTTGTAAAGAAATAAAATAAATTAAGATGT
Flanking genome sequence
(125530 - 125579)
----+----*----+----*----+----*----+----*----+----*
AACCATTAGCCTCATCTTTACTCCCGAAAGCTCACTTTGCTTTTAGTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 75176395 75201923 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1102 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW54515	100.0	SEC24 related g...	Homo sapiens
P53992	99.9	Protein transpo...	Homo sapiens
XP_001145058	99.5	SEC24-related p...	Pan troglodytes
CAH92936	98.0	hypothetical pr...	Pongo abelii
CAH91410	97.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018298	8.2e-73	56.5	KIAA0755

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 143 252 PD026943 NULL

HMMPfam IPR006895 429 468 PF04810 Zinc finger

IPR006896 507 754 PF04811 Sec23/Sec24 trunk region

IPR012990 756 840 PF08033 Sec23/Sec24 beta-sandwich

IPR006900 852 955 PF04815 Sec23/Sec24 helical region

IPR007123 969 1044 PF00626 Gelsolin region

ScanRegExp IPR001360 988 996 PS00572 Glycoside hydrolase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	143	252	PD026943	NULL
HMMPfam	IPR006895	429	468	PF04810	Zinc finger
IPR006896	507	754	PF04811	Sec23/Sec24 trunk region
IPR012990	756	840	PF08033	Sec23/Sec24 beta-sandwich
IPR006900	852	955	PF04815	Sec23/Sec24 helical region
IPR007123	969	1044	PF00626	Gelsolin region
ScanRegExp	IPR001360	988	996	PS00572	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GTTTCTCTGCTTTCACTGCTC
Primer_r	: GAAATGAGAGGTCCAGAGCAG
PCR product length	: 479 bp
PCR conditions	: 95 °C15 sec65 °C120 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1064 bp
Genome contig ID	gi89161187f_75076395
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TTTAATTTGTAAAGAAATAAAATAAATTAAGATGT
Flanking genome sequence (125530 - 125579)	----+--------+--------+--------+--------+----* AACCATTAGCCTCATCTTTACTCCCGAAAGCTCACTTTGCTTTTAGTCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	75176395	75201923	23	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0079

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information