HUGE |
Gene/Protein Characteristic Table for KIAA0079 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06755 |
---|---|
Accession No. : | D38555 |
Description : | Protein transport protein Sec24C. |
HUGO Gene Name : | SEC24 family, member C (S. cerevisiae) (SEC24C) |
Clone Name : | ha03543 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4463 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1064 bp Genome contig ID gi89161187f_75076395 PolyA signal sequence
(AATAAA,-15) +----*----+----*----+----*----+----
TTTAATTTGTAAAGAAATAAAATAAATTAAGATGTFlanking genome sequence
(125530 - 125579) ----+----*----+----*----+----*----+----*----+----*
AACCATTAGCCTCATCTTTACTCCCGAAAGCTCACTTTGCTTTTAGTCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 75176395 75201923 23 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1102 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 10 |
: Stanford G3 | |
: GTTTCTCTGCTTTCACTGCTC | |
: GAAATGAGAGGTCCAGAGCAG | |
: 479 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |