HUGE

Gene/Protein Characteristic Table for KIAA0755

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00623
Accession No. :	AB018298
Description :	Protein transport protein Sec24D.
HUGO Gene Name :	SEC24 family, member D (S. cerevisiae) (SEC24D)
Clone Name :	hk04532 [Vector Info]
Flexi ORF Clone :	pF1KSDA0755
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3988 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1093 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAD28756	100.0	sec24D protein ...	Homo sapiens
O94855	99.9	Protein transpo...	Homo sapiens
BAF84454	99.7	unnamed protein...	Homo sapiens
AAH35761	99.8	SEC24 related g...	Homo sapiens
XP_001503301	92.7	similar to SEC2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38555	5.6e-73	56.5	KIAA0079

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006895 420 459 PF04810 Zinc finger

IPR006896 498 745 PF04811 Sec23/Sec24 trunk region

IPR012990 747 831 PF08033 Sec23/Sec24 beta-sandwich

IPR006900 843 946 PF04815 Sec23/Sec24 helical region

IPR007123 960 1035 PF00626 Gelsolin region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006895	420	459	PF04810	Zinc finger
IPR006896	498	745	PF04811	Sec23/Sec24 trunk region
IPR012990	747	831	PF08033	Sec23/Sec24 beta-sandwich
IPR006900	843	946	PF04815	Sec23/Sec24 helical region
IPR007123	960	1035	PF00626	Gelsolin region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GATAATCTCCTTCTTGGTGCC

Primer_r
: TCTAAATGCCATCTCTTCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GATAATCTCCTTCTTGGTGCC
Primer_r	: TCTAAATGCCATCTCTTCCTG
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0755

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information