HUGE |
Gene/Protein Characteristic Table for KIAA0081 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00399 |
---|---|
Accession No. : | D42039 |
Description : | Mesoderm development candidate 2. |
HUGO Gene Name : | mesoderm development candidate 2 (MESDC2) |
Clone Name : | ha01009s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0081 |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha01009, former representative clones for KIAA0081 with ha01009s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4174 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3466 bp Genome contig ID gi51511731r_78955150 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
GATCTAATAAATTTGGATGATATCTTTTGACTATCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTATGAAACCTGTATCAGATATACACATCTTTCCTTCTTCATCCTCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 r 79055150 79069190 3 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 235 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 15 |
: Genebridge 4 | |
: ACTGAGGGGAGCCAACATAAG | |
: TTAGTAGAGACAGGGCTTCAC | |
: 198 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |