HUGE

Gene/Protein Characteristic Table for KIAA0097

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	D43948
Description :	Cytoskeleton-associated protein 5.
HUGO Gene Name :	cytoskeleton associated protein 5 (CKAP5)
Clone Name :	ha00943 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6629 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 482 bp

Genome contig ID gi51511727r_46621662
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TCTTTTATAAATAAAGTTTGCATTAACTATACCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTCCCAAGATGCTCCATATCATGGAGTGTTGGGCAGCAATTTTTTAACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 46721662 46799397 43 99.9 Terminal No-hit

Features of the protein sequence	Description

Length: 2038 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14008	100.0	Cytoskeleton-as...	Homo sapiens
XP_001165782	99.8	colonic and hep...	Pan troglodytes
XP_001165753	99.3	colonic and hep...	Pan troglodytes
XP_508402	99.5	colonic and hep...	Pan troglodytes
XP_001915280	96.9	cytoskeleton as...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 440 476 PF02985 HEAT

IPR000357 1020 1055 PF02985 HEAT

IPR000357 1367 1403 PF02985 HEAT

ProfileScan IPR000357 446 484 PS50077 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	440	476	PF02985	HEAT
IPR000357	1020	1055	PF02985	HEAT
IPR000357	1367	1403	PF02985	HEAT
ProfileScan	IPR000357	446	484	PS50077	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TGGCGAGAAAGCAGTAAAACC
Primer_r	: ATGTCCTTTGTGTCCTTATCT
PCR product length	: 175 bp
PCR conditions	: 95 °C15 sec62 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	482 bp
Genome contig ID	gi51511727r_46621662
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TCTTTTATAAATAAAGTTTGCATTAACTATACCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCCCAAGATGCTCCATATCATGGAGTGTTGGGCAGCAATTTTTTAACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	46721662	46799397	43	99.9	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0097

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information