HUGE

Gene/Protein Characteristic Table for KIAA0098

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00408
Accession No. :	D43950
Description :	T-complex protein 1 subunit epsilon.
HUGO Gene Name :	chaperonin containing TCP1, subunit 5 (epsilon) (CCT5)
Clone Name :	bm00714 [Vector Info]
Flexi ORF Clone :	pF1KSDA0098
Source :	Human adult brain
Note :	We replaced ha01413, former representative clones for KIAA0098 with bm00714. (2001/10/06)

Features of the cloned DNA sequence	Description

Length: 1891 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 228 bp

Genome contig ID gi51511721f_10203416
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TTTGTATTCATTGTATTAAAAGAATCTGTTTAAAC
Flanking genome sequence
(114709 - 114758)
----+----*----+----*----+----*----+----*----+----*
AACCTTTATCTTCTCTTCGGGTTTAAGAAACGTTTATTGTAACAGTAATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 10303416 10318123 11 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 553 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P48643	1.2e-212	100.0	T-complex prote...	Homo sapiens
AAH02971	7e-212	100.0	Unknown (protei...	Homo sapiens
Q5RF02	7e-212	99.6	T-complex prote...	Pongo abelii
BAF83082	9.4e-212	99.6	unnamed protein...	Homo sapiens
XP_848303	2e-210	98.3	similar to T-co...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13627	1.1e-45	31.6	KIAA0002

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002423 58 74 PR00304 Chaperonin Cpn60/TCP-1

IPR001844 60 86 PR00298 Chaperonin Cpn60

IPR002423 80 98 PR00304 Chaperonin Cpn60/TCP-1

IPR002423 110 129 PR00304 Chaperonin Cpn60/TCP-1

IPR001844 112 139 PR00298 Chaperonin Cpn60

IPR002423 396 418 PR00304 Chaperonin Cpn60/TCP-1

IPR001844 416 437 PR00298 Chaperonin Cpn60

IPR002423 430 442 PR00304 Chaperonin Cpn60/TCP-1

HMMPfam IPR002423 56 550 PF00118 Chaperonin Cpn60/TCP-1

HMMTigr IPR012718 18 549 TIGR02343 T-complex protein 1

ScanRegExp IPR002194 61 73 PS00750 Chaperonin TCP-1

IPR002194 82 98 PS00751 Chaperonin TCP-1

IPR002194 110 118 PS00995 Chaperonin TCP-1

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	58	74	PR00304	Chaperonin Cpn60/TCP-1
IPR001844	60	86	PR00298	Chaperonin Cpn60
IPR002423	80	98	PR00304	Chaperonin Cpn60/TCP-1
IPR002423	110	129	PR00304	Chaperonin Cpn60/TCP-1
IPR001844	112	139	PR00298	Chaperonin Cpn60
IPR002423	396	418	PR00304	Chaperonin Cpn60/TCP-1
IPR001844	416	437	PR00298	Chaperonin Cpn60
IPR002423	430	442	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	56	550	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012718	18	549	TIGR02343	T-complex protein 1
ScanRegExp	IPR002194	61	73	PS00750	Chaperonin TCP-1
IPR002194	82	98	PS00751	Chaperonin TCP-1
IPR002194	110	118	PS00995	Chaperonin TCP-1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CCCACCTTAGAACAGTATGCC
Primer_r	: TCATCTCCTTCACCTGTCTGG
PCR product length	: 136 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	228 bp
Genome contig ID	gi51511721f_10203416
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTTGTATTCATTGTATTAAAAGAATCTGTTTAAAC
Flanking genome sequence (114709 - 114758)	----+--------+--------+--------+--------+----* AACCTTTATCTTCTCTTCGGGTTTAAGAAACGTTTATTGTAACAGTAATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	10303416	10318123	11	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0098

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information