HUGE |
Gene/Protein Characteristic Table for KIAA0098 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00408 |
---|---|
Accession No. : | D43950 |
Description : | T-complex protein 1 subunit epsilon. |
HUGO Gene Name : | chaperonin containing TCP1, subunit 5 (epsilon) (CCT5) |
Clone Name : | bm00714 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0098
![]() |
Source : | Human adult brain |
Note : | We replaced ha01413, former representative clones for KIAA0098 with bm00714. (2001/10/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1891 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 228 bp Genome contig ID gi51511721f_10203416 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
TTTGTATTCATTGTATTAAAAGAATCTGTTTAAACFlanking genome sequence
(114709 - 114758) ----+----*----+----*----+----*----+----*----+----*
AACCTTTATCTTCTCTTCGGGTTTAAGAAACGTTTATTGTAACAGTAATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 10303416 10318123 11 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 553 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 5 |
: Stanford G3 | |
: CCCACCTTAGAACAGTATGCC | |
: TCATCTCCTTCACCTGTCTGG | |
: 136 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |