HUGE

Gene/Protein Characteristic Table for KIAA0002

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04489
Accession No. :	D13627
Description :	T-complex protein 1 subunit theta.
HUGO Gene Name :
Clone Name :	ha00029 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1821 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 146 bp

Genome contig ID gi51511750r_29250521
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGGCTGGATGTTATAATAAACATATTGTTACTGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCCTTATTGTCTAATGACCACGGTTATTGGCTCTAAATGACTTGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 r 29350521 29367810 15 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 555 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P50990	99.6	T-complex prote...	Homo sapiens
BAD96210	99.5	chaperonin cont...	Homo sapiens
Q4R5J0	99.1	T-complex prote...	Macaca fascicularis
XP_531416	99.1	similar to Chap...	Pan troglodytes
EAX09924	99.1	chaperonin cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D43950	1.7e-49	31.6	KIAA0098

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002423 48 64 PR00304 Chaperonin Cpn60/TCP-1

IPR002423 70 88 PR00304 Chaperonin Cpn60/TCP-1

IPR002423 100 119 PR00304 Chaperonin Cpn60/TCP-1

IPR002423 381 403 PR00304 Chaperonin Cpn60/TCP-1

IPR002423 415 427 PR00304 Chaperonin Cpn60/TCP-1

HMMPfam IPR002423 46 536 PF00118 Chaperonin Cpn60/TCP-1

HMMTigr IPR012721 17 546 TIGR02346 T-complex protein 1

ScanRegExp IPR002194 51 63 PS00750 Chaperonin TCP-1

IPR002194 72 88 PS00751 Chaperonin TCP-1

IPR002194 100 108 PS00995 Chaperonin TCP-1

IPR001969 289 300 PS00141 Peptidase aspartic

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	48	64	PR00304	Chaperonin Cpn60/TCP-1
IPR002423	70	88	PR00304	Chaperonin Cpn60/TCP-1
IPR002423	100	119	PR00304	Chaperonin Cpn60/TCP-1
IPR002423	381	403	PR00304	Chaperonin Cpn60/TCP-1
IPR002423	415	427	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	46	536	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012721	17	546	TIGR02346	T-complex protein 1
ScanRegExp	IPR002194	51	63	PS00750	Chaperonin TCP-1
IPR002194	72	88	PS00751	Chaperonin TCP-1
IPR002194	100	108	PS00995	Chaperonin TCP-1
IPR001969	289	300	PS00141	Peptidase aspartic

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGGTGGCAAAGTGGCAGACAT
Primer_r	: CACCATCGTCTACTACCCTTT
PCR product length	: 308 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	146 bp
Genome contig ID	gi51511750r_29250521
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGGCTGGATGTTATAATAAACATATTGTTACTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCCTTATTGTCTAATGACCACGGTTATTGGCTCTAAATGACTTGTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	r	29350521	29367810	15	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0002

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information