HUGE

Gene/Protein Characteristic Table for KIAA0101

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01958
Accession No. :	D14657
Description :	PCNA-associated factor.
HUGO Gene Name :
Clone Name :	ha00771 [Vector Info]
Flexi ORF Clone :	pF1KA0101
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 836 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 439 bp

Genome contig ID gi51511731r_62344843
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TAGATTTTTGCACATTAAAAAATTCAGTATTAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACATTACTTATTCTACCCTCTTTTTTGGCAAGGAGGACAAATACGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 62444843 62460684 4 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 130 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL26108	4.6e-38	83.1	mCG131663, isof...	Mus musculus
Q6RIA2	6.8e-37	87.4	PCNA-associated...	Rattus norvegicus
EAW77683	1.3e-36	95.1	hCG2039386, iso...	Homo sapiens
EAW77680	4.7e-36	90.8	hCG2039386, iso...	Homo sapiens
Q9CQX4	7.4e-36	84.7	PCNA-associated...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 20 130 PD072652 NULL

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	20	130	PD072652	NULL

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TCAGTTCGTTCTCTCCTCTCC
Primer_r	: TAGTGGCAGAGGTGGAAGAAC
PCR product length	: 138 (0.4k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	439 bp
Genome contig ID	gi51511731r_62344843
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TAGATTTTTGCACATTAAAAAATTCAGTATTAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACATTACTTATTCTACCCTCTTTTTTGGCAAGGAGGACAAATACGCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	62444843	62460684	4	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0101

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information