HUGE |
Gene/Protein Characteristic Table for KIAA0115 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00413 |
---|---|
Accession No. : | D29643 |
Description : | Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit precursor. |
HUGO Gene Name : | dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST) |
Clone Name : | ha00643 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0115
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1668 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 191 bp Genome contig ID gi89161185r_20751268 PolyA signal sequence
(TATAAA,-24) +----*----+----*----+----*----+----
GATAATTTTTATATAAAAGAAGTTTTTCCACTTTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTGCTAAAAGTGGCATTTTTCCTATGTGCAGTCACTCCTCTCATTTCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 20851268 20860587 11 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 456 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 1 |
: Stanford G3 | |
: GGGGGTTATTAGGATTGGTGG | |
: ACCCCTTGGCTCTCAGTGTTG | |
: 103 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |