HUGE

Gene/Protein Characteristic Table for KIAA0117

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06607
Accession No. :	D38491
Description :	RNA-binding protein 34.
HUGO Gene Name :	RNA binding motif protein 34 (RBM34)
Clone Name :	ha01845 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 881 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 197 bp

Genome contig ID gi89161185r_233282426
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTATTGAGTTTACTTAATAAAATGATACTCTTGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGAAAGCCTGCAATGTACTTTGGAGGGTGGATGGGTGACTTATTTACTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 233382426 233391170 5 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 227 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW70007	1.2e-74	100.0	RNA binding mot...	Homo sapiens
P42696	9.1e-72	99.5	RNA-binding pro...	Homo sapiens
XP_001102020	2.5e-70	93.8	RNA binding mot...	Macaca mulatta
AAH29451	5.1e-70	99.5	RNA binding mot...	Homo sapiens
BAF85051	5.8e-70	99.1	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 189 217 PF00076 RNA recognition motif

ProfileScan IPR000504 187 227 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	189	217	PF00076	RNA recognition motif
ProfileScan	IPR000504	187	227	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CCCAGATTCAACCCGTGTACG
Primer_r	: GTGTGTTTCTTCTTCGCTTTC
PCR product length	: 145 (0.4k) bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	197 bp
Genome contig ID	gi89161185r_233282426
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTATTGAGTTTACTTAATAAAATGATACTCTTGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGAAAGCCTGCAATGTACTTTGGAGGGTGGATGGGTGACTTATTTACTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	233382426	233391170	5	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0117

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information