HUGE

Gene/Protein Characteristic Table for KIAA0124

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04281
Accession No. :	D50914
Description :	Ribosome biogenesis protein BOP1.
HUGO Gene Name :	block of proliferation 1 (BOP1)
Clone Name :	ha01534 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2108 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 59 bp

Genome contig ID gi51511724r_145288996
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTGGTCGTGCTGAAGTCAACAGAGCCTTTACCCTG
Flanking genome sequence
(167873 - 167824)
----+----*----+----*----+----*----+----*----+----*
TGCTGCCTGGTGCTCCCACCTTCTTGAATTGGGGTTGCCAACAAAGCCGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 145456869 145483700 15 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 682 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH05160	99.9	BOP1 protein [H...	Homo sapiens
AAH07274	99.9	Similar to bloc...	Homo sapiens
Q14137	99.9	Ribosome biogen...	Homo sapiens
BAF83366	99.6	unnamed protein...	Homo sapiens
BAG37981	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 344 378 PD000018 WD40 repeat

HMMPfam IPR012953 80 338 PF08145 BOP1

IPR001680 339 377 PF00400 WD40 repeat

IPR001680 506 542 PF00400 WD40 repeat

IPR001680 546 584 PF00400 WD40 repeat

IPR001680 589 627 PF00400 WD40 repeat

IPR001680 644 682 PF00400 WD40 repeat

HMMSmart IPR001680 338 377 SM00320 WD40 repeat

IPR001680 380 419 SM00320 WD40 repeat

IPR001680 458 501 SM00320 WD40 repeat

IPR001680 504 542 SM00320 WD40 repeat

IPR001680 545 584 SM00320 WD40 repeat

IPR001680 588 627 SM00320 WD40 repeat

IPR001680 639 682 SM00320 WD40 repeat

ProfileScan IPR001680 345 386 PS50082 WD40 repeat

IPR001680 345 386 PS50294 WD40 repeat

IPR001680 511 682 PS50294 WD40 repeat

IPR001680 595 625 PS50082 WD40 repeat

ScanRegExp IPR001680 364 378 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	344	378	PD000018	WD40 repeat
HMMPfam	IPR012953	80	338	PF08145	BOP1
IPR001680	339	377	PF00400	WD40 repeat
IPR001680	506	542	PF00400	WD40 repeat
IPR001680	546	584	PF00400	WD40 repeat
IPR001680	589	627	PF00400	WD40 repeat
IPR001680	644	682	PF00400	WD40 repeat
HMMSmart	IPR001680	338	377	SM00320	WD40 repeat
IPR001680	380	419	SM00320	WD40 repeat
IPR001680	458	501	SM00320	WD40 repeat
IPR001680	504	542	SM00320	WD40 repeat
IPR001680	545	584	SM00320	WD40 repeat
IPR001680	588	627	SM00320	WD40 repeat
IPR001680	639	682	SM00320	WD40 repeat
ProfileScan	IPR001680	345	386	PS50082	WD40 repeat
IPR001680	345	386	PS50294	WD40 repeat
IPR001680	511	682	PS50294	WD40 repeat
IPR001680	595	625	PS50082	WD40 repeat
ScanRegExp	IPR001680	364	378	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ATGATGACGAAGGCGACGAGG
Primer_r	: GCTGTCCTCCGCATACTCATC
PCR product length	: 219 (0.3k) bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	59 bp
Genome contig ID	gi51511724r_145288996
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGGTCGTGCTGAAGTCAACAGAGCCTTTACCCTG
Flanking genome sequence (167873 - 167824)	----+--------+--------+--------+--------+----* TGCTGCCTGGTGCTCCCACCTTCTTGAATTGGGGTTGCCAACAAAGCCGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	145456869	145483700	15	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0124

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information