HUGE

Gene/Protein Characteristic Table for KIAA0126

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00418
Accession No. :	D50916
Description :	Ubiquitin conjugation factor E4 A.
HUGO Gene Name :	ubiquitination factor E4A (UFD2 homolog, yeast) (UBE4A)
Clone Name :	ha03786 [Vector Info]
Flexi ORF Clone :	pF1KSDA0126
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6060 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2766 bp

Genome contig ID gi51511727f_117640964
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCAAAACTTGTATTTAATAAATGAACATCTGACTT
Flanking genome sequence
(134170 - 134219)
----+----*----+----*----+----*----+----*----+----*
ACAACCTTTGTTATCACTTTATTCCAGTATTAAAAGCTAGTGGCAGTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 117735569 117775132 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1075 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09613	100.0	ubiquitin conju...	synthetic construct
EAW67371	99.9	hCG2033105, iso...	Homo sapiens
XP_508791	99.6	ubiquitination ...	Pan troglodytes
Q14139	99.2	Ubiquitin conju...	Homo sapiens
XP_001161169	98.9	ubiquitination ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014584	1e-40	27.4	KIAA0684

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003613 996 1070 PF04564 U box

HMMSmart IPR003613 1000 1063 SM00504 U box

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	996	1070	PF04564	U box
HMMSmart	IPR003613	1000	1063	SM00504	U box

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TATCATCCTCCTTTCCCTCTC
Primer_r	: GCCTTCTGAGTTTTTGTGCCC
PCR product length	: 175 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2766 bp
Genome contig ID	gi51511727f_117640964
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCAAAACTTGTATTTAATAAATGAACATCTGACTT
Flanking genome sequence (134170 - 134219)	----+--------+--------+--------+--------+----* ACAACCTTTGTTATCACTTTATTCCAGTATTAAAAGCTAGTGGCAGTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	117735569	117775132	20	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0126

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information