HUGE

Gene/Protein Characteristic Table for KIAA0128

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00023
Accession No. :	D50918
Description :	Septin-6.
HUGO Gene Name :	septin 6 (SEPT6)
Clone Name :	ha03961 [Vector Info]
Flexi ORF Clone :	pF1KA0128
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4612 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3335 bp

Genome contig ID gi89161218r_118534939
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
ATATGTGCTTGTTTTTAATTAAAACAAGAAGCTTT
Flanking genome sequence
(258722 - 258673)
----+----*----+----*----+----*----+----*----+----*
ACAGGAAGTAGTGAATAGGAATGAGGCTGGAGAGGTAAGCAGACGCCAGA

Features of the protein sequence	Description

Length: 424 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAK98547	2.2e-142	100.0	SEPTIN6 type I ...	Homo sapiens
AAK98551	2.2e-142	100.0	SEPTIN6 type V ...	Homo sapiens
CAI41427	2.2e-142	100.0	septin 6 [Homo ...	Homo sapiens
Q14141	2.2e-142	100.0	Septin-6.	Homo sapiens
EAW89857	2.4e-142	100.0	septin 6, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86957	5.8e-75	77.7	KIAA0202
AB023208	1.4e-27	44.4	KIAA0991
D63878	7.2e-27	41.1	KIAA0158

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000038 142 195 PD002565 Cell division/GTP binding protein

HMMPfam IPR000038 36 309 PF00735 Cell division/GTP binding protein

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	142	195	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	36	309	PF00735	Cell division/GTP binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CCTTAACCCAATGACCCAGTG
Primer_r	: CTACAGTGAGAAAAGCTACCC
PCR product length	: 194 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3335 bp
Genome contig ID	gi89161218r_118534939
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- ATATGTGCTTGTTTTTAATTAAAACAAGAAGCTTT
Flanking genome sequence (258722 - 258673)	----+--------+--------+--------+--------+----* ACAGGAAGTAGTGAATAGGAATGAGGCTGGAGAGGTAAGCAGACGCCAGA

Gene/Protein Characteristic Table for KIAA0128

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information