HUGE

Gene/Protein Characteristic Table for KIAA0202

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00456
Accession No. :	D86957
Description :	Septin-8.
HUGO Gene Name :	septin 8 (SEPT8)
Clone Name :	ha02944 [Vector Info]
Flexi ORF Clone :	pF1KSDA0202
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4344 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2816 bp

Genome contig ID gi51511721r_132019596
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ACTTATTTTTTTCATTAAATTTTGCATTTATTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTTTTGTGGTGTCTTTTTTGGGCAGTAGCTTTTCTGATTTAACGTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 132119596 132140966 10 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 508 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAO13879	8e-164	100.0	septin SEPT8_v2...	Homo sapiens
AAH49819	1.3e-140	96.7	Sept8 protein [...	Mus musculus
EDL33585	7.6e-136	91.7	septin 8, isofo...	Mus musculus
EAW62316	2.8e-135	100.0	hCG24127, isofo...	Homo sapiens
Q92599	3.1e-135	100.0	Septin-8.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50918	2.2e-69	77.7	KIAA0128
D63878	3.1e-25	41.2	KIAA0158
AB023208	3.4e-25	41.2	KIAA0991

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000038 226 279 PD002565 Cell division/GTP binding protein

HMMPfam IPR000038 120 392 PF00735 Cell division/GTP binding protein

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	226	279	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	120	392	PF00735	Cell division/GTP binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTAGGTGGTTTGTAATTGTGC
Primer_r	: AAAACAGTCAATGAATGCAGG
PCR product length	: 190 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2816 bp
Genome contig ID	gi51511721r_132019596
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTTATTTTTTTCATTAAATTTTGCATTTATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTTTTGTGGTGTCTTTTTTGGGCAGTAGCTTTTCTGATTTAACGTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	132119596	132140966	10	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0202

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information