HUGE

Gene/Protein Characteristic Table for KIAA0145

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04764
Accession No. :	D63479
Description :	Diacylglycerol kinase delta.
HUGO Gene Name :	diacylglycerol kinase, delta 130kDa (DGKD)
Clone Name :	hg01767 [Vector Info]
Source :	Human adult brain
Note :	We replaced ha00914, former representative clones for KIAA0145 with hg01767. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6238 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2640 bp

Genome contig ID gi89161199f_233827952
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
GTGTATAAATAAAACAAGCCTGTTTTTGATCTTCC
Flanking genome sequence
(217532 - 217581)
----+----*----+----*----+----*----+----*----+----*
ATCGCCAGAGTCTTTGTCATCATTCCTTGTGCTTTGACATAAAGTGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 233927951 234045482 30 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1198 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q16760	100.0	Diacylglycerol ...	Homo sapiens
BAC11809	99.9	diacylglycerol ...	Homo sapiens
EAW71048	99.9	diacylglycerol ...	Homo sapiens
BAA11134	99.2	diacylglycerol ...	Homo sapiens
XP_001114920	97.5	similar to diac...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018261	3.6e-16	36.7	KIAA0718
AB028945	0.00011	24.0	KIAA1022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001206 306 401 PD005043 Diacylglycerol kinase

IPR000756 879 925 PD002939 Diacylglycerol kinase accessory region

FPrintScan IPR002219 161 170 PR00008 Protein kinase C

IPR002219 174 185 PR00008 Protein kinase C

IPR002219 186 198 PR00008 Protein kinase C

HMMPfam IPR001849 38 130 PF00169 Pleckstrin-like

IPR002219 148 200 PF00130 Protein kinase C

IPR002219 220 273 PF00130 Protein kinase C

IPR001206 305 430 PF00781 Diacylglycerol kinase

IPR000756 747 904 PF00609 Diacylglycerol kinase accessory region

IPR011510 1126 1192 PF07647 Sterile alpha motif homology 2

HMMSmart IPR001849 38 132 SM00233 Pleckstrin-like

IPR002219 148 197 SM00109 Protein kinase C

IPR002219 220 270 SM00109 Protein kinase C

IPR001206 305 430 SM00046 Diacylglycerol kinase

IPR000756 747 904 SM00045 Diacylglycerol kinase accessory region

IPR001660 1126 1192 SM00454 Sterile alpha motif SAM

ProfileScan IPR001849 37 130 PS50003 Pleckstrin-like

IPR002219 147 197 PS50081 Protein kinase C

IPR002219 219 270 PS50081 Protein kinase C

IPR001660 1129 1192 PS50105 Sterile alpha motif SAM

ScanRegExp IPR002219 148 197 PS00479 Protein kinase C

IPR002219 220 270 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001206	306	401	PD005043	Diacylglycerol kinase
IPR000756	879	925	PD002939	Diacylglycerol kinase accessory region
FPrintScan	IPR002219	161	170	PR00008	Protein kinase C
IPR002219	174	185	PR00008	Protein kinase C
IPR002219	186	198	PR00008	Protein kinase C
HMMPfam	IPR001849	38	130	PF00169	Pleckstrin-like
IPR002219	148	200	PF00130	Protein kinase C
IPR002219	220	273	PF00130	Protein kinase C
IPR001206	305	430	PF00781	Diacylglycerol kinase
IPR000756	747	904	PF00609	Diacylglycerol kinase accessory region
IPR011510	1126	1192	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001849	38	132	SM00233	Pleckstrin-like
IPR002219	148	197	SM00109	Protein kinase C
IPR002219	220	270	SM00109	Protein kinase C
IPR001206	305	430	SM00046	Diacylglycerol kinase
IPR000756	747	904	SM00045	Diacylglycerol kinase accessory region
IPR001660	1126	1192	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001849	37	130	PS50003	Pleckstrin-like
IPR002219	147	197	PS50081	Protein kinase C
IPR002219	219	270	PS50081	Protein kinase C
IPR001660	1129	1192	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR002219	148	197	PS00479	Protein kinase C
IPR002219	220	270	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGAGGAAGGAATGAACATGAG
Primer_r	: AGCACTCAGGTATGGACTATG
PCR product length	: 313 bp
PCR conditions	: 95 °C15 sec60 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2640 bp
Genome contig ID	gi89161199f_233827952
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GTGTATAAATAAAACAAGCCTGTTTTTGATCTTCC
Flanking genome sequence (217532 - 217581)	----+--------+--------+--------+--------+----* ATCGCCAGAGTCTTTGTCATCATTCCTTGTGCTTTGACATAAAGTGTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	233927951	234045482	30	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0145

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information