HUGE |
Gene/Protein Characteristic Table for KIAA0145 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04764 |
---|---|
Accession No. : | D63479 |
Description : | Diacylglycerol kinase delta. |
HUGO Gene Name : | diacylglycerol kinase, delta 130kDa (DGKD) |
Clone Name : | hg01767 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced ha00914, former representative clones for KIAA0145 with hg01767. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6238 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2640 bp Genome contig ID gi89161199f_233827952 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
GTGTATAAATAAAACAAGCCTGTTTTTGATCTTCCFlanking genome sequence
(217532 - 217581) ----+----*----+----*----+----*----+----*----+----*
ATCGCCAGAGTCTTTGTCATCATTCCTTGTGCTTTGACATAAAGTGTTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 233927951 234045482 30 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1198 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: Genebridge 4 | |
: TGAGGAAGGAATGAACATGAG | |
: AGCACTCAGGTATGGACTATG | |
: 313 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |