HUGE

Gene/Protein Characteristic Table for KIAA0718

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04763
Accession No. :	AB018261
Description :	Diacylglycerol kinase beta.
HUGO Gene Name :	diacylglycerol kinase, beta 90kDa (DGKB)
Clone Name :	hk01073 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3742 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 742 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6T7	100.0	Diacylglycerol ...	Homo sapiens
XP_518977	99.9	diacylglycerol ...	Pan troglodytes
XP_001148960	99.9	diacylglycerol ...	Pan troglodytes
XP_001105384	99.2	diacylglycerol ...	Macaca mulatta
XP_539445	98.5	similar to Diac...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63479	3.9e-19	36.7	KIAA0145

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 92 156 PD000012 Calcium-binding EF-hand

IPR001206 368 471 PD005043 Diacylglycerol kinase

IPR000756 677 719 PD002939 Diacylglycerol kinase accessory region

FPrintScan IPR002219 180 194 PR00008 Protein kinase C

IPR002219 196 205 PR00008 Protein kinase C

IPR002219 209 220 PR00008 Protein kinase C

IPR002219 221 233 PR00008 Protein kinase C

HMMPfam IPR002048 91 119 PF00036 Calcium-binding EF-hand

IPR002048 136 164 PF00036 Calcium-binding EF-hand

IPR002219 183 235 PF00130 Protein kinase C

IPR002219 248 299 PF00130 Protein kinase C

IPR001206 376 500 PF00781 Diacylglycerol kinase

IPR000756 520 700 PF00609 Diacylglycerol kinase accessory region

HMMSmart IPR002048 91 119 SM00054 Calcium-binding EF-hand

IPR002048 136 164 SM00054 Calcium-binding EF-hand

IPR002219 181 232 SM00109 Protein kinase C

IPR002219 248 296 SM00109 Protein kinase C

IPR001206 376 500 SM00046 Diacylglycerol kinase

IPR000756 520 700 SM00045 Diacylglycerol kinase accessory region

ProfileScan IPR002048 87 122 PS50222 Calcium-binding EF-hand

IPR002048 132 167 PS50222 Calcium-binding EF-hand

IPR002219 182 232 PS50081 Protein kinase C

IPR002219 247 296 PS50081 Protein kinase C

ScanRegExp IPR002048 100 112 PS00018 Calcium-binding EF-hand

IPR002048 145 157 PS00018 Calcium-binding EF-hand

IPR002219 183 232 PS00479 Protein kinase C

IPR002219 247 298 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	92	156	PD000012	Calcium-binding EF-hand
IPR001206	368	471	PD005043	Diacylglycerol kinase
IPR000756	677	719	PD002939	Diacylglycerol kinase accessory region
FPrintScan	IPR002219	180	194	PR00008	Protein kinase C
IPR002219	196	205	PR00008	Protein kinase C
IPR002219	209	220	PR00008	Protein kinase C
IPR002219	221	233	PR00008	Protein kinase C
HMMPfam	IPR002048	91	119	PF00036	Calcium-binding EF-hand
IPR002048	136	164	PF00036	Calcium-binding EF-hand
IPR002219	183	235	PF00130	Protein kinase C
IPR002219	248	299	PF00130	Protein kinase C
IPR001206	376	500	PF00781	Diacylglycerol kinase
IPR000756	520	700	PF00609	Diacylglycerol kinase accessory region
HMMSmart	IPR002048	91	119	SM00054	Calcium-binding EF-hand
IPR002048	136	164	SM00054	Calcium-binding EF-hand
IPR002219	181	232	SM00109	Protein kinase C
IPR002219	248	296	SM00109	Protein kinase C
IPR001206	376	500	SM00046	Diacylglycerol kinase
IPR000756	520	700	SM00045	Diacylglycerol kinase accessory region
ProfileScan	IPR002048	87	122	PS50222	Calcium-binding EF-hand
IPR002048	132	167	PS50222	Calcium-binding EF-hand
IPR002219	182	232	PS50081	Protein kinase C
IPR002219	247	296	PS50081	Protein kinase C
ScanRegExp	IPR002048	100	112	PS00018	Calcium-binding EF-hand
IPR002048	145	157	PS00018	Calcium-binding EF-hand
IPR002219	183	232	PS00479	Protein kinase C
IPR002219	247	298	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGCAATTAGCTCCCTCCTCC

Primer_r
: AGAGACTCCAACTATGCCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGCAATTAGCTCCCTCCTCC
Primer_r	: AGAGACTCCAACTATGCCATG
PCR product length	: 121 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0718

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information