HUGE |
Gene/Protein Characteristic Table for KIAA0162 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07029 |
---|---|
Accession No. : | D79984 |
Description : | Transcription elongation factor SPT6. |
HUGO Gene Name : | suppressor of Ty 6 homolog (S. cerevisiae) (SUPT6H) |
Clone Name : | ha03982 [Vector Info] |
Flexi ORF Clone : | pF1KA0162
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5876 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 605 bp Genome contig ID gi51511734f_23913429 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CCTGCCTGTCATTTGAATAAACAGTGTTTCTATTGFlanking genome sequence
(139948 - 139997) ----+----*----+----*----+----*----+----*----+----*
AGCTCTTGCCAAAGCCTCTCTCTCCAACTCTCCAGCTCTTTGAGGGGTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 24013429 24053375 37 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1730 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 17 |
: Stanford G3 | |
: TTATTCAGTTTGGGGCAGGAG | |
: TCAAATGACAGGCAGGAAGCG | |
: 171 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |