HUGE

Gene/Protein Characteristic Table for KIAA0166

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05777
Accession No. :	D79988
Description :	Kinetochore-associated protein 1.
HUGO Gene Name :	kinetochore associated 1 (KNTC1)
Clone Name :	ha02362 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6942 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 149 bp

Genome contig ID gi89161190f_121477762
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
ATTACCCCACATGTAATAAATAAAACAATATGAGC
Flanking genome sequence
(199117 - 199166)
----+----*----+----*----+----*----+----*----+----*
ATAATTGCCCCATAAAGAACTCATGTCCTGAATTAATAAGTCTTTTCATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 121577762 121676877 64 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2228 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P50748	100.0	Kinetochore-ass...	Homo sapiens
EAW98333	100.0	kinetochore ass...	Homo sapiens
XP_001168340	99.5	Rough Deal homo...	Pan troglodytes
XP_001492639	91.6	similar to Kine...	Equus caballus
Q8C3Y4	81.0	Kinetochore-ass...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR004827 1736 1750 PS00036 Basic-leucine zipper (bZIP) transcription factor

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR004827	1736	1750	PS00036	Basic-leucine zipper (bZIP) transcription factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AAGAGCATATGAACACGGGCC
Primer_r	: TCAGAATTTCACAGGGAGCAG
PCR product length	: 279 (0.5k) bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	149 bp
Genome contig ID	gi89161190f_121477762
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATTACCCCACATGTAATAAATAAAACAATATGAGC
Flanking genome sequence (199117 - 199166)	----+--------+--------+--------+--------+----* ATAATTGCCCCATAAAGAACTCATGTCCTGAATTAATAAGTCTTTTCATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	121577762	121676877	64	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0166

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information