HUGE

Gene/Protein Characteristic Table for KIAA0167

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00439
Accession No. :	D79989
Description :	Centaurin-gamma 1.
HUGO Gene Name :
Clone Name :	ha01026 [Vector Info]
Flexi ORF Clone :	pF1KSDA0167
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3950 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1351 bp

Genome contig ID gi89161190r_56305251
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CTTCTTCAACAGCAATTAAAGAGGAAGTGATTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCTAGGGGGTGAGCTGCTGGTCTGTTCTTGGAGGCAGGTCAGGGCATGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 56405251 56422209 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 844 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAL04171	0	100.0	centaurin gamma...	Homo sapiens
XP_001116290	0	98.6	centaurin, gamm...	Macaca mulatta
XP_001917890	0	96.8	centaurin, gamm...	Equus caballus
XP_576238	0	95.8	similar to Cent...	Rattus norvegicus
EAW97048	6.2e-170	97.7	centaurin, gamm...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029022	7.3e-42	55.8	KIAA1099
AB075855	3.4e-36	48.5	KIAA1975
AB051503	4.4e-10	38.9	KIAA1716
D26069	2.3e-09	38.7	KIAA0041
AB033075	4.2e-09	29.8	KIAA1249

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001806 79 100 PR00449 Ras GTPase

IPR001806 216 238 PR00449 Ras GTPase

IPR001164 595 614 PR00405 Arf GTPase activating protein

IPR001164 614 631 PR00405 Arf GTPase activating protein

IPR001164 635 656 PR00405 Arf GTPase activating protein

IPR002110 743 755 PR01415 Ankyrin

IPR002110 755 767 PR01415 Ankyrin

HMMPfam IPR013684 80 190 PF08477 Miro-like

IPR001849 349 562 PF00169 Pleckstrin-like

IPR001164 583 703 PF01412 Arf GTPase activating protein

IPR002110 742 774 PF00023 Ankyrin

IPR002110 775 800 PF00023 Ankyrin

HMMSmart IPR003577 76 244 SM00173 Ras small GTPase

IPR003579 79 241 SM00175 Ras small GTPase

IPR001849 349 564 SM00233 Pleckstrin-like

IPR001164 583 703 SM00105 Arf GTPase activating protein

ProfileScan IPR001849 348 562 PS50003 Pleckstrin-like

IPR001164 583 703 PS50115 Arf GTPase activating protein

IPR002110 742 774 PS50088 Ankyrin

IPR002110 742 799 PS50297 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	79	100	PR00449	Ras GTPase
IPR001806	216	238	PR00449	Ras GTPase
IPR001164	595	614	PR00405	Arf GTPase activating protein
IPR001164	614	631	PR00405	Arf GTPase activating protein
IPR001164	635	656	PR00405	Arf GTPase activating protein
IPR002110	743	755	PR01415	Ankyrin
IPR002110	755	767	PR01415	Ankyrin
HMMPfam	IPR013684	80	190	PF08477	Miro-like
IPR001849	349	562	PF00169	Pleckstrin-like
IPR001164	583	703	PF01412	Arf GTPase activating protein
IPR002110	742	774	PF00023	Ankyrin
IPR002110	775	800	PF00023	Ankyrin
HMMSmart	IPR003577	76	244	SM00173	Ras small GTPase
IPR003579	79	241	SM00175	Ras small GTPase
IPR001849	349	564	SM00233	Pleckstrin-like
IPR001164	583	703	SM00105	Arf GTPase activating protein
ProfileScan	IPR001849	348	562	PS50003	Pleckstrin-like
IPR001164	583	703	PS50115	Arf GTPase activating protein
IPR002110	742	774	PS50088	Ankyrin
IPR002110	742	799	PS50297	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AAACTGGGTGATAGGGCGGAC
Primer_r	: AAGATTCACACCACTGCCTCC
PCR product length	: 215 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1351 bp
Genome contig ID	gi89161190r_56305251
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CTTCTTCAACAGCAATTAAAGAGGAAGTGATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCTAGGGGGTGAGCTGCTGGTCTGTTCTTGGAGGCAGGTCAGGGCATGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	56405251	56422209	18	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0167

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information