HUGE

Gene/Protein Characteristic Table for KIAA1975

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05737
Accession No. :	AB075855
Description :
HUGO Gene Name :	ankyrin repeat and GTPase domain Arf GTPase activating protein 11 (AGAP11)
Clone Name :	aj01061 [Vector Info]
Flexi ORF Clone :	pF1KA1975
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 4559 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 298 bp

Genome contig ID gi89161187f_88642143
PolyA signal sequence
(AATATA,-21)
+----*----+----*----+----*----+----
ATAAGATGTGTGAAAATATATTTGAAAAAAAGTTC
Flanking genome sequence
(117799 - 117848)
----+----*----+----*----+----*----+----*----+----*
ATAAATATGCATTGATTTTTGTACATATGGCACCTCTTTTTCATTTTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 88742143 88759940 7 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 597 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW80309	1.8e-190	100.0	hCG1994053, iso...	Homo sapiens
XP_001082744	2.2e-172	82.2	similar to cent...	Macaca mulatta
NP_055729	3.4e-172	82.4	centaurin, gamm...	Homo sapiens
EAW71079	4e-172	82.2	centaurin, gamm...	Homo sapiens
AAL04172	9.7e-172	82.0	centaurin gamma...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029022	8.8e-128	82.0	KIAA1099
D79989	2.5e-52	48.5	KIAA0167
AB051503	5.4e-16	41.0	KIAA1716
AB033075	8.4e-16	31.4	KIAA1249
D26069	7.3e-15	31.6	KIAA0041

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001164 387 406 PR00405 Arf GTPase activating protein

IPR001164 406 423 PR00405 Arf GTPase activating protein

IPR001164 427 448 PR00405 Arf GTPase activating protein

IPR002110 535 547 PR01415 Ankyrin

IPR002110 580 592 PR01415 Ankyrin

HMMPfam IPR001849 169 354 PF00169 Pleckstrin-like

IPR001164 375 495 PF01412 Arf GTPase activating protein

IPR002110 534 566 PF00023 Ankyrin

IPR002110 567 592 PF00023 Ankyrin

HMMSmart IPR001849 169 356 SM00233 Pleckstrin-like

IPR001164 375 495 SM00105 Arf GTPase activating protein

IPR002110 534 563 SM00248 Ankyrin

IPR002110 567 596 SM00248 Ankyrin

ProfileScan IPR001849 168 354 PS50003 Pleckstrin-like

IPR001164 375 495 PS50115 Arf GTPase activating protein

IPR002110 502 591 PS50297 Ankyrin

IPR002110 534 566 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	387	406	PR00405	Arf GTPase activating protein
IPR001164	406	423	PR00405	Arf GTPase activating protein
IPR001164	427	448	PR00405	Arf GTPase activating protein
IPR002110	535	547	PR01415	Ankyrin
IPR002110	580	592	PR01415	Ankyrin
HMMPfam	IPR001849	169	354	PF00169	Pleckstrin-like
IPR001164	375	495	PF01412	Arf GTPase activating protein
IPR002110	534	566	PF00023	Ankyrin
IPR002110	567	592	PF00023	Ankyrin
HMMSmart	IPR001849	169	356	SM00233	Pleckstrin-like
IPR001164	375	495	SM00105	Arf GTPase activating protein
IPR002110	534	563	SM00248	Ankyrin
IPR002110	567	596	SM00248	Ankyrin
ProfileScan	IPR001849	168	354	PS50003	Pleckstrin-like
IPR001164	375	495	PS50115	Arf GTPase activating protein
IPR002110	502	591	PS50297	Ankyrin
IPR002110	534	566	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCAGAGCCATCCCCATTAAAC

Primer_r
: TTCCTGGGACTTTGATGGTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	298 bp
Genome contig ID	gi89161187f_88642143
PolyA signal sequence (AATATA,-21)	+--------+--------+----*----+---- ATAAGATGTGTGAAAATATATTTGAAAAAAAGTTC
Flanking genome sequence (117799 - 117848)	----+--------+--------+--------+--------+----* ATAAATATGCATTGATTTTTGTACATATGGCACCTCTTTTTCATTTTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	88742143	88759940	7	99.5	Perfect prediction

Primer_f	: GCAGAGCCATCCCCATTAAAC
Primer_r	: TTCCTGGGACTTTGATGGTAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1975

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information