HUGE |
Gene/Protein Characteristic Table for KIAA1975 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05737 |
---|---|
Accession No. : | AB075855 |
Description : | |
HUGO Gene Name : | ankyrin repeat and GTPase domain Arf GTPase activating protein 11 (AGAP11) |
Clone Name : | aj01061 [Vector Info] |
Flexi ORF Clone : | pF1KA1975
![]() |
Source : | Human brain (amygdala) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4559 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 298 bp Genome contig ID gi89161187f_88642143 PolyA signal sequence
(AATATA,-21) +----*----+----*----+----*----+----
ATAAGATGTGTGAAAATATATTTGAAAAAAAGTTCFlanking genome sequence
(117799 - 117848) ----+----*----+----*----+----*----+----*----+----*
ATAAATATGCATTGATTTTTGTACATATGGCACCTCTTTTTCATTTTTAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 88742143 88759940 7 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 597 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCAGAGCCATCCCCATTAAAC | |
: TTCCTGGGACTTTGATGGTAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |