HUGE

Gene/Protein Characteristic Table for KIAA0170

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00441
Accession No. :	D79992
Description :	Mediator of DNA damage checkpoint protein 1.
HUGO Gene Name :	mediator of DNA damage checkpoint 1 (MDC1)
Clone Name :	ha02399 [Vector Info]
Flexi ORF Clone :	pF1KSDA0170
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6940 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 657 bp

Genome contig ID gi89161210r_30675564
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ACCTCTGTGATAAATAAATATTCACTCTGTGCCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGGTGTAGTGTAGTTTTTTAAAATGTCTAGGTCTCAAGACACAAACTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 30775564 30790936 14 99.4 Terminal No-hit

Features of the protein sequence	Description

Length: 2090 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09636	100.0	mediator of DNA...	synthetic construct
Q14676	99.8	Mediator of DNA...	Homo sapiens
CAI41891	99.8	mediator of DNA...	Homo sapiens
CAM25929	99.8	mediator of DNA...	Homo sapiens
BAE78617	99.4	mediator of DNA...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	6.7e-05	21.5	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000253 55 125 PF00498 Forkhead-associated

IPR001357 1907 1958 PF00533 BRCT

IPR001357 1992 2029 PF00533 BRCT

HMMSmart IPR000253 54 106 SM00240 Forkhead-associated

ProfileScan IPR000253 55 101 PS50006 Forkhead-associated

IPR001357 1893 1971 PS50172 BRCT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	55	125	PF00498	Forkhead-associated
IPR001357	1907	1958	PF00533	BRCT
IPR001357	1992	2029	PF00533	BRCT
HMMSmart	IPR000253	54	106	SM00240	Forkhead-associated
ProfileScan	IPR000253	55	101	PS50006	Forkhead-associated
IPR001357	1893	1971	PS50172	BRCT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGATTTGAGGGTCCAGTTATG
Primer_r	: TCACAGAGGTCAAGCCGAAGC
PCR product length	: 156 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	657 bp
Genome contig ID	gi89161210r_30675564
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACCTCTGTGATAAATAAATATTCACTCTGTGCCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGTGTAGTGTAGTTTTTTAAAATGTCTAGGTCTCAAGACACAAACTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	30775564	30790936	14	99.4	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0170

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information