| HUGE | 
| Gene/Protein Characteristic Table for KIAA0170 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00441 | 
|---|---|
| Accession No. : | D79992 | 
| Description : | Mediator of DNA damage checkpoint protein 1. | 
| HUGO Gene Name : | mediator of DNA damage checkpoint 1 (MDC1) | 
| Clone Name : | ha02399 [Vector Info] | 
| Flexi ORF Clone : | pF1KSDA0170  | 
| Source : | Myeloblast cell line (KG-1) | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 6940 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | NO | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 657 bp Genome contig ID gi89161210r_30675564 PolyA signal sequence 
(AATAAA,-23)
ACCTCTGTGATAAATAAATATTCACTCTGTGCCTTFlanking genome sequence 
(100000 - 99951)
ATGGTGTAGTGTAGTTTTTTAAAATGTCTAGGTCTCAAGACACAAACTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 30775564 30790936 14 99.4 Terminal No-hit 
| Features of the protein sequence | Description | |
|---|---|---|
Length: 2090 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | Expression profile | Description | |
|---|---|---|
| RH mapping information | Description | |
|---|---|---|
| : 6 | 
| : Genebridge 4 | |
| : AGATTTGAGGGTCCAGTTATG | |
| : TCACAGAGGTCAAGCCGAAGC | |
| : 156 bp | |
| : 95 °C | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |