HUGE

Gene/Protein Characteristic Table for KIAA0324

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01067
Accession No. :	AB002322
Description :	Serine/arginine repetitive matrix protein 2.
HUGO Gene Name :	serine/arginine repetitive matrix 2 (SRRM2)
Clone Name :	ee08846s1 [Vector Info]
Flexi ORF Clone :	pF1KA0324
Source :
Note :	We replaced hg00514, former representative clones for KIAA0324 with ee08846s1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 9003 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 543 bp

Genome contig ID gi51511732f_2642767
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AACTTTTTCTGTCAAATAAAAATGAGAAATGCAGG
Flanking genome sequence
(118647 - 118696)
----+----*----+----*----+----*----+----*----+----*
AACTGGGTCTGTAGACTGTTTATTAAAGGTGTGTTAAGGGGGCAGCCACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 2742679 2761412 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 2800 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10316	100.0	serine/arginine...	synthetic construct
Q9UQ35	100.0	Serine/arginine...	Homo sapiens
BAA83718	99.9	RNA binding pro...	Homo sapiens
EAW85479	99.6	serine/arginine...	Homo sapiens
EAW85482	85.0	serine/arginine...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058756	4.9e-07	31.9	KIAA1853
AB011108	1.5e-05	28.9	KIAA0536
AB028942	0.00055	30.3	KIAA1019
AB011125	0.00081	24.3	KIAA0553

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013170 99 143 PF08312 mRNA splicing factor

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013170	99	143	PF08312	mRNA splicing factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CAACCTCATGGGGGACAGTAG

Primer_r
: GTATCCAGAAGTTCCCAGGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAACCTCATGGGGGACAGTAG
Primer_r	: GTATCCAGAAGTTCCCAGGGG
PCR product length	: 122 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	543 bp
Genome contig ID	gi51511732f_2642767
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACTTTTTCTGTCAAATAAAAATGAGAAATGCAGG
Flanking genome sequence (118647 - 118696)	----+--------+--------+--------+--------+----* AACTGGGTCTGTAGACTGTTTATTAAAGGTGTGTTAAGGGGGCAGCCACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	2742679	2761412	15	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0324

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information