HUGE

Gene/Protein Characteristic Table for KIAA0553

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01091
Accession No. :	AB011125
Description :	G patch domain-containing protein 8.
HUGO Gene Name :
Clone Name :	pf08859 [Vector Info]
Flexi ORF Clone :	pF1KA0553
Source :	Human brain (hippocampus)
Note :	We replaced hh00875, former representative clones for KIAA0553 with pf08859. (1998/4/10)

Features of the cloned DNA sequence	Description

Length: 8115 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2284 bp

Genome contig ID gi51511734r_39728178
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GGAAAGGAACTTTCTAATAAACCAATGATTTGTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTAGCAGAGTCTGTCGTAATTGTTGCCCCATCCACTCAAAGTTAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 39828178 39898829 7 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 1450 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001002909	99.7	G patch domain ...	Homo sapiens
XP_001150098	99.2	hypothetical pr...	Pan troglodytes
XP_001150301	99.2	hypothetical pr...	Pan troglodytes
XP_001149918	99.6	hypothetical pr...	Pan troglodytes
XP_001114589	98.3	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	1.9e-06	24.7	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR007087 84 113 PS50157 Zinc finger

ScanRegExp IPR007087 86 108 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR007087	84	113	PS50157	Zinc finger
ScanRegExp	IPR007087	86	108	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGGTGGGAGGGCAGTCAAGAG

Primer_r
: GCTAGAATTGGTTGGTTGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGTGGGAGGGCAGTCAAGAG
Primer_r	: GCTAGAATTGGTTGGTTGGTC
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2284 bp
Genome contig ID	gi51511734r_39728178
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GGAAAGGAACTTTCTAATAAACCAATGATTTGTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTAGCAGAGTCTGTCGTAATTGTTGCCCCATCCACTCAAAGTTAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	39828178	39898829	7	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0553

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information