HUGE |
Gene/Protein Characteristic Table for KIAA1019 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK06942 |
---|---|
Accession No. : | AB028942 |
Description : | SON protein. |
HUGO Gene Name : | SON DNA binding protein (SON) |
Clone Name : | fg00188s1 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fg00188, former representative clones for KIAA1019 with fg00188s1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7466 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 530 bp Genome contig ID gi51511750f_33737245 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CCTTTGCTGTATCTTTTAATAAACAGTTTACTTTTFlanking genome sequence
(117594 - 117643) ----+----*----+----*----+----*----+----*----+----*
ATTTAACTTGTTGTGCAAAATCACGCTTGGGGGATGTGGGAGGGTGGAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 21 f 33837245 33854837 7 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2309 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 21 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |