HUGE

Gene/Protein Characteristic Table for KIAA1019

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK06942
Accession No. :	AB028942
Description :	SON protein.
HUGO Gene Name :	SON DNA binding protein (SON)
Clone Name :	fg00188s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fg00188, former representative clones for KIAA1019 with fg00188s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 7466 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 530 bp

Genome contig ID gi51511750f_33737245
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CCTTTGCTGTATCTTTTAATAAACAGTTTACTTTT
Flanking genome sequence
(117594 - 117643)
----+----*----+----*----+----*----+----*----+----*
ATTTAACTTGTTGTGCAAAATCACGCTTGGGGGATGTGGGAGGGTGGAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 f 33837245 33854837 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 2309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_115571	99.9	SON DNA-binding...	Homo sapiens
AAL34498	99.9	SON DNA binding...	Homo sapiens
EAX09820	99.9	SON DNA binding...	Homo sapiens
XP_001165738	99.7	SON DNA-binding...	Pan troglodytes
NP_620305	99.9	SON DNA-binding...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	2.7e-05	30.3	KIAA0324
AB011108	8.5e-05	33.4	KIAA0536

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR004829 388 445 PD153432 Cell surface antigen

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004829	388	445	PD153432	Cell surface antigen

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	530 bp
Genome contig ID	gi51511750f_33737245
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTTTGCTGTATCTTTTAATAAACAGTTTACTTTT
Flanking genome sequence (117594 - 117643)	----+--------+--------+--------+--------+----* ATTTAACTTGTTGTGCAAAATCACGCTTGGGGGATGTGGGAGGGTGGAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	f	33837245	33854837	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1019

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information