HUGE

Gene/Protein Characteristic Table for KIAA0536

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01088
Accession No. :	AB011108
Description :	Serine/threonine-protein kinase PRP4 homolog.
HUGO Gene Name :	PRP4 pre-mRNA processing factor 4 homolog B (yeast) (PRPF4B)
Clone Name :	hg03863 [Vector Info]
Flexi ORF Clone :	pF1KA0536
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6680 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1028 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13523	100.0	Serine/threonin...	Homo sapiens
CAI20480	99.9	PRP4 pre-mRNA p...	Homo sapiens
BAF83933	99.8	unnamed protein...	Homo sapiens
Q5R814	99.7	Serine/threonin...	Pongo abelii
XP_848551	98.2	similar to seri...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	7.8e-09	28.9	KIAA0324
AB028942	3.7e-06	33.4	KIAA1019
AB058756	5.7e-06	27.0	KIAA1853
AB020641	6.7e-05	29.7	KIAA0834
AB023153	0.00028	26.2	KIAA0936

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 715 933 PD000001 Protein kinase

HMMPfam IPR000719 708 1024 PF00069 Protein kinase

HMMSmart IPR001245 708 1022 SM00219 Tyrosine protein kinase

IPR002290 708 1024 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 708 1024 PS50011 Protein kinase

ScanRegExp IPR008271 832 844 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	715	933	PD000001	Protein kinase
HMMPfam	IPR000719	708	1024	PF00069	Protein kinase
HMMSmart	IPR001245	708	1022	SM00219	Tyrosine protein kinase
IPR002290	708	1024	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	708	1024	PS50011	Protein kinase
ScanRegExp	IPR008271	832	844	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GTTGAGATCTGGAAAGCATAG

Primer_r
: GGTGAATATAAGATGCTCCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTTGAGATCTGGAAAGCATAG
Primer_r	: GGTGAATATAAGATGCTCCCC
PCR product length	: 119 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0536

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information