HUGE

Gene/Protein Characteristic Table for KIAA1853

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00288
Accession No. :	AB058756
Description :
HUGO Gene Name :
Clone Name :	hj04155 [Vector Info]
Flexi ORF Clone :	pF1KA1853
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5206 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3078 bp

Genome contig ID gi89161190f_117803779
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCAGGGGAAAGCACAAAGCTATTTCTGAAATTAGG
Flanking genome sequence
(278293 - 278342)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGGTGGAAGGAGCAGCCAGATGTTCCACAGGACCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 117903779 118082070 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 708 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB01611	3.4e-78	99.3	unnamed protein...	Macaca fascicularis
EDM13842	3e-41	86.2	similar to RIKE...	Rattus norvegicus
CAG08167	6.1e-32	41.6	unnamed protein...	Tetraodon nigro...
NP_001103669	5.5e-26	32.9	hypothetical pr...	Homo sapiens
Q80WV7	1.7e-25	33.5	SRRM2-like protein.	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	3.5e-11	31.8	KIAA0324
AB011108	4e-06	26.7	KIAA0536
AB011125	0.001	25.1	KIAA0553

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCATGGCTGACACAAAACAC

Primer_r
: GGGAATGTTCAGCAGATGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTGGATGAAAATGATGTCTG
Primer_r	: GTGATCCTGCTATGTGCCTTG
PCR product length	: 95 bp
PCR conditions	: 15 °C62 sec60 °C30 sec150 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3078 bp
Genome contig ID	gi89161190f_117803779
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAGGGGAAAGCACAAAGCTATTTCTGAAATTAGG
Flanking genome sequence (278293 - 278342)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGTGGAAGGAGCAGCCAGATGTTCCACAGGACCCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	117903779	118082070	13	99.4	Perfect prediction

Primer_f	: TGCATGGCTGACACAAAACAC
Primer_r	: GGGAATGTTCAGCAGATGGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1853

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information