HUGE

Gene/Protein Characteristic Table for KIAA0834

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00136
Accession No. :	AB020641
Description :	Serine/threonine-protein kinase PFTAIRE-1.
HUGO Gene Name :
Clone Name :	hj05353 [Vector Info]
Flexi ORF Clone :	pF1KA0834
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4957 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3457 bp

Genome contig ID gi89161213f_90076648
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ACATGATATGGAATAAAGTATAGCAGAATCTCCGT
Flanking genome sequence
(601194 - 601243)
----+----*----+----*----+----*----+----*----+----*
ACATGTTCTAGGTACATCTTCTTGGTGGATGCCCAGTAAGAGCATATACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 90176648 90677840 14 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABY63621	6.1e-178	99.8	PFTAIRE protein...	Papio anubis
EAL24162	3.6e-177	100.0	PFTAIRE protein...	Homo sapiens
AAX41040	3.6e-177	100.0	PFTAIRE protein...	synthetic construct
EAW76872	3.8e-177	100.0	PFTAIRE protein...	Homo sapiens
ACA35057	7.3e-177	99.6	PFTAIRE protein...	Callicebus moloch

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023153	2.9e-27	37.4	KIAA0936
AB020711	7e-22	33.5	KIAA0904
AB033104	1.5e-19	33.3	KIAA1278
AB028951	8.2e-16	33.5	KIAA1028
AB058763	1.4e-14	30.0	KIAA1860

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 119 322 PD000001 Protein kinase

HMMPfam IPR000719 119 403 PF00069 Protein kinase

HMMSmart IPR001245 119 403 SM00219 Tyrosine protein kinase

IPR002290 119 403 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 119 403 PS50011 Protein kinase

ScanRegExp IPR000719 125 148 PS00107 Protein kinase

IPR001199 204 211 PS00191 Cytochrome b5

IPR008271 236 248 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	119	322	PD000001	Protein kinase
HMMPfam	IPR000719	119	403	PF00069	Protein kinase
HMMSmart	IPR001245	119	403	SM00219	Tyrosine protein kinase
IPR002290	119	403	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	119	403	PS50011	Protein kinase
ScanRegExp	IPR000719	125	148	PS00107	Protein kinase
IPR001199	204	211	PS00191	Cytochrome b5
IPR008271	236	248	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCATTCCTTTTCCCACAGCAG

Primer_r
: CAATCCCCTGTTAGAAAGTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3457 bp
Genome contig ID	gi89161213f_90076648
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ACATGATATGGAATAAAGTATAGCAGAATCTCCGT
Flanking genome sequence (601194 - 601243)	----+--------+--------+--------+--------+----* ACATGTTCTAGGTACATCTTCTTGGTGGATGCCCAGTAAGAGCATATACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	90176648	90677840	14	99.3	Perfect prediction

Primer_f	: TCATTCCTTTTCCCACAGCAG
Primer_r	: CAATCCCCTGTTAGAAAGTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0834

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information