HUGE |
Gene/Protein Characteristic Table for KIAA0904 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04632 |
---|---|
Accession No. : | AB020711 |
Description : | Cell division cycle 2-related protein kinase 7. |
HUGO Gene Name : | Cdc2-related kinase, arginine/serine-rich (CRKRS) |
Clone Name : | ha00554 [Vector Info] |
Flexi ORF Clone : | pF1KA0904 |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced hk10050, former representative clones for KIAA0904 with ha00554. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5896 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1139 bp Genome contig ID gi51511734f_34771540 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATTTAGCATATTGTTTACACATATATTTTTATGTCFlanking genome sequence
(170702 - 170751) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAACAAAAACCTTTCAAACAGAGCATTGTGATATTGTCAAAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 34871540 34942240 14 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1535 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCACCTCCTCTTTTGATTCTC | |
: TGTAACTGGGGGACTTGACTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: CCACCTCCTCTTTTGATTCTC | |
: TGTAACTGGGGGACTTGACTG | |
: 126 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |