HUGE

Gene/Protein Characteristic Table for KIAA0904

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04632
Accession No. :	AB020711
Description :	Cell division cycle 2-related protein kinase 7.
HUGO Gene Name :	Cdc2-related kinase, arginine/serine-rich (CRKRS)
Clone Name :	ha00554 [Vector Info]
Flexi ORF Clone :	pF1KA0904
Source :	Myeloblast cell line (KG-1)
Note :	We replaced hk10050, former representative clones for KIAA0904 with ha00554. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5896 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1139 bp

Genome contig ID gi51511734f_34771540
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTTAGCATATTGTTTACACATATATTTTTATGTC
Flanking genome sequence
(170702 - 170751)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAACAAAAACCTTTCAAACAGAGCATTGTGATATTGTCAAAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 34871540 34942240 14 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1535 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50266	100.0	CRKRS protein [...	Homo sapiens
EAW60577	99.9	Cdc2-related ki...	Homo sapiens
XP_001088486	98.6	CDC2-related pr...	Macaca mulatta
CAM21268	91.2	Cdc2-related ki...	Mus musculus
EAW60576	99.3	Cdc2-related ki...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058694	4.4e-22	44.3	KIAA1791
AB020641	2.9e-06	33.5	KIAA0834
AB023153	7.9e-06	27.9	KIAA0936
AB028951	2.6e-05	31.2	KIAA1028
AB002322	0.00034	22.3	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 781 1073 PD000001 Protein kinase

HMMPfam IPR000719 781 1074 PF00069 Protein kinase

HMMSmart IPR001245 781 1074 SM00219 Tyrosine protein kinase

IPR002290 781 1074 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 781 1074 PS50011 Protein kinase

ScanRegExp IPR000719 787 810 PS00107 Protein kinase

IPR008271 909 921 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	781	1073	PD000001	Protein kinase
HMMPfam	IPR000719	781	1074	PF00069	Protein kinase
HMMSmart	IPR001245	781	1074	SM00219	Tyrosine protein kinase
IPR002290	781	1074	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	781	1074	PS50011	Protein kinase
ScanRegExp	IPR000719	787	810	PS00107	Protein kinase
IPR008271	909	921	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACCTCCTCTTTTGATTCTC

Primer_r
: TGTAACTGGGGGACTTGACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACCTCCTCTTTTGATTCTC
Primer_r	: TGTAACTGGGGGACTTGACTG
PCR product length	: 126 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1139 bp
Genome contig ID	gi51511734f_34771540
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTTAGCATATTGTTTACACATATATTTTTATGTC
Flanking genome sequence (170702 - 170751)	----+--------+--------+--------+--------+----* AAAAAAAAAACAAAAACCTTTCAAACAGAGCATTGTGATATTGTCAAAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	34871540	34942240	14	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0904

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information