HUGE

Gene/Protein Characteristic Table for KIAA1028

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04502
Accession No. :	AB028951
Description :	Cell division cycle 2-like protein kinase 6.
HUGO Gene Name :	cell division cycle 2-like 6 (CDK8-like) (CDC2L6)
Clone Name :	fh00176s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1028
Source :	Human fetal brain
Note :	We replaced fh00176, former representative clones for KIAA1028 with fh00176s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6063 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4557 bp

Genome contig ID gi89161210r_110937874
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATATTCTTGGTTGAAATAAAATTTAATTGACTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTCTGTGTGGATTTTTTAAATATAAAAAAAATCTTATAATAAGGCTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 111037874 111243029 12 100.0 Internal No-hit

Features of the protein sequence	Description

Length: 501 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BWU1	5.9e-150	100.0	Cell division c...	Homo sapiens
BAF85049	1.5e-149	99.8	unnamed protein...	Homo sapiens
XP_589209	1.4e-146	98.2	similar to cell...	Bos taurus
Q8BWD8	4.6e-144	96.4	Cell division c...	Mus musculus
EDL87847	5.7e-144	96.4	cell division c...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020711	2.5e-09	31.2	KIAA0904
AB020641	1.5e-07	33.5	KIAA0834
AB023153	2.2e-06	32.4	KIAA0936
AB018265	0.00031	24.9	KIAA0722
AB029024	0.00082	25.7	KIAA1101

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 27 239 PD000001 Protein kinase

HMMPfam IPR000719 19 334 PF00069 Protein kinase

HMMSmart IPR001245 20 332 SM00219 Tyrosine protein kinase

IPR002290 20 334 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 20 334 PS50011 Protein kinase

ScanRegExp IPR000719 26 51 PS00107 Protein kinase

IPR008271 146 158 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	27	239	PD000001	Protein kinase
HMMPfam	IPR000719	19	334	PF00069	Protein kinase
HMMSmart	IPR001245	20	332	SM00219	Tyrosine protein kinase
IPR002290	20	334	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	20	334	PS50011	Protein kinase
ScanRegExp	IPR000719	26	51	PS00107	Protein kinase
IPR008271	146	158	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTATGAGGCTGAAACAATCC

Primer_r
: CAAAAGAGTAGTGCAGAAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTATGAGGCTGAAACAATCC
Primer_r	: CAAAAGAGTAGTGCAGAAGGC
PCR product length	: 139 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4557 bp
Genome contig ID	gi89161210r_110937874
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATATTCTTGGTTGAAATAAAATTTAATTGACTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCTGTGTGGATTTTTTAAATATAAAAAAAATCTTATAATAAGGCTTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	111037874	111243029	12	100.0	Internal No-hit

Gene/Protein Characteristic Table for KIAA1028

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information