HUGE

Gene/Protein Characteristic Table for KIAA1101

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06251
Accession No. :	AB029024
Description :	Serine/threonine-protein kinase OSR1.
HUGO Gene Name :	oxidative-stress responsive 1 (OXSR1)
Clone Name :	hk08029 [Vector Info]
Flexi ORF Clone :	pF1KA1101
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4272 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2593 bp

Genome contig ID gi89161205f_38082290
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTTCTTCATTTTTAATCAATAAAGAGTAAATTGTC
Flanking genome sequence
(189691 - 189740)
----+----*----+----*----+----*----+----*----+----*
CTTAGTGGTGTATGGACGCTTTATTTTAGTGGCCGTTGGCGGAGAGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 38182273 38271979 18 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O95747	5.4e-164	100.0	Serine/threonin...	Homo sapiens
AAQ02425	5.4e-164	100.0	oxidative-stres...	synthetic construct
XP_526174	2.6e-163	99.6	hypothetical pr...	Pan troglodytes
Q5R495	3.8e-163	99.4	Serine/threonin...	Pongo abelii
EAW64525	9.9e-163	100.0	oxidative-stres...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86959	3.5e-21	29.5	KIAA0204
AB011123	1.2e-18	39.2	KIAA0551
AB014587	2.6e-18	39.0	KIAA0687
AB032968	9e-12	39.7	KIAA1142
AB020688	2.7e-11	33.1	KIAA0881

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 3 231 PD000001 Protein kinase

HMMPfam IPR000719 3 231 PF00069 Protein kinase

HMMSmart IPR001245 3 231 SM00219 Tyrosine protein kinase

IPR002290 3 231 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 1 231 PS50011 Protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	3	231	PD000001	Protein kinase
HMMPfam	IPR000719	3	231	PF00069	Protein kinase
HMMSmart	IPR001245	3	231	SM00219	Tyrosine protein kinase
IPR002290	3	231	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	231	PS50011	Protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGGTTCCAGTGGGCGTCTTC

Primer_r
: AGACCTGAGTTGTGAAATTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2593 bp
Genome contig ID	gi89161205f_38082290
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTCTTCATTTTTAATCAATAAAGAGTAAATTGTC
Flanking genome sequence (189691 - 189740)	----+--------+--------+--------+--------+----* CTTAGTGGTGTATGGACGCTTTATTTTAGTGGCCGTTGGCGGAGAGCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	38182273	38271979	18	99.4	Perfect prediction

Primer_f	: CAGGTTCCAGTGGGCGTCTTC
Primer_r	: AGACCTGAGTTGTGAAATTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1101

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information