HUGE |
Gene/Protein Characteristic Table for KIAA1101 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06251 |
---|---|
Accession No. : | AB029024 |
Description : | Serine/threonine-protein kinase OSR1. |
HUGO Gene Name : | oxidative-stress responsive 1 (OXSR1) |
Clone Name : | hk08029 [Vector Info] |
Flexi ORF Clone : | pF1KA1101
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4272 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2593 bp Genome contig ID gi89161205f_38082290 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TTTCTTCATTTTTAATCAATAAAGAGTAAATTGTCFlanking genome sequence
(189691 - 189740) ----+----*----+----*----+----*----+----*----+----*
CTTAGTGGTGTATGGACGCTTTATTTTAGTGGCCGTTGGCGGAGAGCTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 38182273 38271979 18 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 467 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAGGTTCCAGTGGGCGTCTTC | |
: AGACCTGAGTTGTGAAATTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |