HUGE

Gene/Protein Characteristic Table for KIAA1142

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00749
Accession No. :	AB032968
Description :	Serine/threonine-protein kinase PAK 4.
HUGO Gene Name :
Clone Name :	hh05864 [Vector Info]
Flexi ORF Clone :	pF1KSDA1142
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5742 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4244 bp

Genome contig ID gi42406306f_44208314
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCACTCCAGCCTGGGTGACAGAGTGAGATTCCGTC
Flanking genome sequence
(156984 - 157033)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGACAAAAAACAACAGGTACGGTGGCTTACACCTGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 44308314 44365296 9 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD38914	9.7e-126	100.0	hypothetical pr...	Homo sapiens
XP_867241	5.7e-121	95.9	similar to p21-...	Canis lupus fam...
EAW56862	4.7e-108	89.1	p21(CDKN1A)-act...	Homo sapiens
AAH34511	3.5e-105	87.4	PAK4 protein [H...	Homo sapiens
BAG56999	1.1e-104	95.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033090	9e-43	65.6	KIAA1264
D86959	1.3e-12	33.6	KIAA0204
AB020688	3.9e-12	35.9	KIAA0881
AB037782	7e-12	37.0	KIAA1361
AB011123	4.3e-11	38.6	KIAA0551

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 203 447 PD000001 Protein kinase

HMMPfam IPR000095 39 96 PF00786 PAK-box/P21-Rho-binding

IPR000719 197 448 PF00069 Protein kinase

HMMSmart IPR000095 40 75 SM00285 PAK-box/P21-Rho-binding

IPR001245 197 448 SM00219 Tyrosine protein kinase

IPR002290 197 448 SM00220 Serine/threonine protein kinase

ProfileScan IPR000095 40 53 PS50108 PAK-box/P21-Rho-binding

IPR000719 197 448 PS50011 Protein kinase

ScanRegExp IPR000719 203 227 PS00107 Protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	203	447	PD000001	Protein kinase
HMMPfam	IPR000095	39	96	PF00786	PAK-box/P21-Rho-binding
IPR000719	197	448	PF00069	Protein kinase
HMMSmart	IPR000095	40	75	SM00285	PAK-box/P21-Rho-binding
IPR001245	197	448	SM00219	Tyrosine protein kinase
IPR002290	197	448	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000095	40	53	PS50108	PAK-box/P21-Rho-binding
IPR000719	197	448	PS50011	Protein kinase
ScanRegExp	IPR000719	203	227	PS00107	Protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGTCATAGCAGCCAGTAAGC

Primer_r
: TACTCACCAAACGCGCTCAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4244 bp
Genome contig ID	gi42406306f_44208314
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCCAGCCTGGGTGACAGAGTGAGATTCCGTC
Flanking genome sequence (156984 - 157033)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGACAAAAAACAACAGGTACGGTGGCTTACACCTGTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	44308314	44365296	9	99.2	Perfect prediction

Primer_f	: AGGTCATAGCAGCCAGTAAGC
Primer_r	: TACTCACCAAACGCGCTCAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1142

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information