HUGE

Gene/Protein Characteristic Table for KIAA1264

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00788
Accession No. :	AB033090
Description :	Serine/threonine-protein kinase PAK 7.
HUGO Gene Name :	p21 protein (Cdc42/Rac)-activated kinase 7 (PAK7)
Clone Name :	hj01058 [Vector Info]
Flexi ORF Clone :	pF1KSDA1264
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4777 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2070 bp

Genome contig ID gi51511747r_9366038
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
ACTGCATTTGCAAATAAAAATAAATGTTTGCCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCCCATTGTGTTATTGGAAACAGTGATTTCTCAAATTTATTTTATTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 9466038 9767689 11 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 753 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525261	99.6	p21-activated k...	Pan troglodytes
XP_001113709	99.2	p21-activated k...	Macaca mulatta
Q9P286	100.0	Serine/threonin...	Homo sapiens
BAF84090	99.9	unnamed protein...	Homo sapiens
BAF98711	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032968	1.1e-58	65.6	KIAA1142
D86959	4.9e-18	34.8	KIAA0204
AB037782	1.5e-16	35.9	KIAA1361
AB020688	2.8e-16	35.9	KIAA0881
AB011123	1.3e-15	38.9	KIAA0551

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 488 733 PD000001 Protein kinase

HMMPfam IPR000095 44 101 PF00786 PAK-box/P21-Rho-binding

IPR000719 483 734 PF00069 Protein kinase

HMMSmart IPR000095 45 80 SM00285 PAK-box/P21-Rho-binding

IPR001245 483 734 SM00219 Tyrosine protein kinase

IPR002290 483 734 SM00220 Serine/threonine protein kinase

ProfileScan IPR000095 45 58 PS50108 PAK-box/P21-Rho-binding

IPR000719 483 734 PS50011 Protein kinase

ScanRegExp IPR000719 489 513 PS00107 Protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	488	733	PD000001	Protein kinase
HMMPfam	IPR000095	44	101	PF00786	PAK-box/P21-Rho-binding
IPR000719	483	734	PF00069	Protein kinase
HMMSmart	IPR000095	45	80	SM00285	PAK-box/P21-Rho-binding
IPR001245	483	734	SM00219	Tyrosine protein kinase
IPR002290	483	734	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000095	45	58	PS50108	PAK-box/P21-Rho-binding
IPR000719	483	734	PS50011	Protein kinase
ScanRegExp	IPR000719	489	513	PS00107	Protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTATCGTGCTGGAAGTCTG

Primer_r
: AACATGGGCACAACTGAAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGTATCGTGCTGGAAGTCTG
Primer_r	: AACATGGGCACAACTGAAGTC
PCR product length	: 94 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2070 bp
Genome contig ID	gi51511747r_9366038
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACTGCATTTGCAAATAAAAATAAATGTTTGCCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCCATTGTGTTATTGGAAACAGTGATTTCTCAAATTTATTTTATTGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	9466038	9767689	11	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1264

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information