| HUGE |
Gene/Protein Characteristic Table for KIAA0551 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01090 |
|---|---|
| Accession No. : | AB011123 |
| Description : | TRAF2 and NCK-interacting protein kinase. |
| HUGO Gene Name : | TRAF2 and NCK interacting kinase (TNIK) |
| Clone Name : | hh00867s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA0551
![]() |
| Source : | Human adult brain |
| Note : | We replaced hh00867, former representative clones for KIAA0551 with hh00867s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5727 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1378 bp Genome contig ID gi89161205r_172162986 PolyA signal sequence
(TATAAA,-31) +----*----+----*----+----*----+----
TCCTTATAAACTCTTACTCAAATGATTTGAACTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TATGCGACTGGGATTTTTTTTTTCCAAAGCTACAAGCATGGCCGCCTGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 172262986 172660812 33 99.8 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1385 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GTATGTTGGGTAATTTGGAGG | |
| : TCCTGTGTTCTCCCTGTGTGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 3 |
| : GeneBridge 4 | |
| : GTATGTTGGGTAATTTGGAGG | |
| : TCCTGTGTTCTCCCTGTGTGG | |
| : 193 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |