HUGE

Gene/Protein Characteristic Table for KIAA0551

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01090
Accession No. :	AB011123
Description :	TRAF2 and NCK-interacting protein kinase.
HUGO Gene Name :	TRAF2 and NCK interacting kinase (TNIK)
Clone Name :	hh00867s1 [Vector Info]
Flexi ORF Clone :	pF1KA0551
Source :	Human adult brain
Note :	We replaced hh00867, former representative clones for KIAA0551 with hh00867s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5727 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1378 bp

Genome contig ID gi89161205r_172162986
PolyA signal sequence
(TATAAA,-31)
+----*----+----*----+----*----+----
TCCTTATAAACTCTTACTCAAATGATTTGAACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATGCGACTGGGATTTTTTTTTTCCAAAGCTACAAGCATGGCCGCCTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 172262986 172660812 33 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKE5	100.0	TRAF2 and NCK-i...	Homo sapiens
XP_001164831	99.9	TRAF2 and NCK i...	Pan troglodytes
XP_001088063	99.9	TRAF2 and NCK i...	Macaca mulatta
AAF03785	99.4	Traf2 and NCK i...	Homo sapiens
XP_001492832	98.8	similar to TRAF...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014587	6.3e-43	63.8	KIAA0687
D86959	1.4e-13	26.7	KIAA0204
AB037782	3.2e-10	30.9	KIAA1361
AB020688	2.9e-09	32.5	KIAA0881
AB032968	2.6e-08	38.6	KIAA1142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 50 313 PD000001 Protein kinase

HMMPfam IPR000719 50 314 PF00069 Protein kinase

IPR001180 1072 1363 PF00780 Citron-like

HMMSmart IPR001245 50 314 SM00219 Tyrosine protein kinase

IPR002290 50 314 SM00220 Serine/threonine protein kinase

IPR001180 1067 1365 SM00036 Citron-like

ProfileScan IPR000719 50 314 PS50011 Protein kinase

ScanRegExp IPR000719 56 79 PS00107 Protein kinase

IPR008271 174 186 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	50	313	PD000001	Protein kinase
HMMPfam	IPR000719	50	314	PF00069	Protein kinase
IPR001180	1072	1363	PF00780	Citron-like
HMMSmart	IPR001245	50	314	SM00219	Tyrosine protein kinase
IPR002290	50	314	SM00220	Serine/threonine protein kinase
IPR001180	1067	1365	SM00036	Citron-like
ProfileScan	IPR000719	50	314	PS50011	Protein kinase
ScanRegExp	IPR000719	56	79	PS00107	Protein kinase
IPR008271	174	186	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GTATGTTGGGTAATTTGGAGG

Primer_r
: TCCTGTGTTCTCCCTGTGTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTATGTTGGGTAATTTGGAGG
Primer_r	: TCCTGTGTTCTCCCTGTGTGG
PCR product length	: 193 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1378 bp
Genome contig ID	gi89161205r_172162986
PolyA signal sequence (TATAAA,-31)	+--------+--------+----*----+---- TCCTTATAAACTCTTACTCAAATGATTTGAACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATGCGACTGGGATTTTTTTTTTCCAAAGCTACAAGCATGGCCGCCTGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	172262986	172660812	33	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0551

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information