HUGE

Gene/Protein Characteristic Table for KIAA0936

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00689
Accession No. :	AB023153
Description :	Serine/threonine-protein kinase ICK.
HUGO Gene Name :	intestinal cell (MAK-like) kinase (ICK)
Clone Name :	hh04647 [Vector Info]
Flexi ORF Clone :	pF1KSDA0936
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6014 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3849 bp

Genome contig ID gi89161210r_52874057
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CTGGTCCAAATAAAGTTGAAGTTTAAGAAAAATTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGAGTGTTCTGTTTTTGTTTTCATGTTCTTCCATTAGTATTTTCTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 52974057 53034446 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPZ9	1.1e-212	100.0	Serine/threonin...	Homo sapiens
BAG52026	1.5e-212	99.8	unnamed protein...	Homo sapiens
XP_001154965	1.1e-210	99.1	intestinal cell...	Pan troglodytes
AAF37278	2.8e-210	99.1	intestinal cell...	Homo sapiens
XP_538964	8.8e-203	93.1	similar to inte...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020641	1.8e-15	37.4	KIAA0834
AB020711	1.9e-11	27.5	KIAA0904
AB037782	1.1e-08	24.4	KIAA1361
AB033104	1.6e-08	25.9	KIAA1278
AB067488	3e-08	24.1	KIAA1901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 15 283 PD000001 Protein kinase

HMMPfam IPR000719 12 292 PF00069 Protein kinase

HMMSmart IPR001245 12 292 SM00219 Tyrosine protein kinase

IPR002290 12 292 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 12 292 PS50011 Protein kinase

ScanRegExp IPR000719 18 42 PS00107 Protein kinase

IPR008271 129 141 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	15	283	PD000001	Protein kinase
HMMPfam	IPR000719	12	292	PF00069	Protein kinase
HMMSmart	IPR001245	12	292	SM00219	Tyrosine protein kinase
IPR002290	12	292	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	12	292	PS50011	Protein kinase
ScanRegExp	IPR000719	18	42	PS00107	Protein kinase
IPR008271	129	141	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGTCATCTTCTGGAGTTATC

Primer_r
: CTGAATGGCACAAAACAATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3849 bp
Genome contig ID	gi89161210r_52874057
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CTGGTCCAAATAAAGTTGAAGTTTAAGAAAAATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGAGTGTTCTGTTTTTGTTTTCATGTTCTTCCATTAGTATTTTCTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	52974057	53034446	14	100.0	Perfect prediction

Primer_f	: GTGTCATCTTCTGGAGTTATC
Primer_r	: CTGAATGGCACAAAACAATGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0936

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information