HUGE

Gene/Protein Characteristic Table for KIAA0174

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00445
Accession No. :	D79996
Description :
HUGO Gene Name :
Clone Name :	ha02422 [Vector Info]
Flexi ORF Clone :	pF1KSDA0174
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2348 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1190 bp

Genome contig ID gi51511732f_70386946
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TAGCTCAGTAGCTGCTAATAAAGTTAAAGATCCTG
Flanking genome sequence
(133463 - 133512)
----+----*----+----*----+----*----+----*----+----*
TGTCCTGCTTTCTCTACTGTTTGGTCAGATGATGAAGTATAAATCTGGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 70486946 70520407 10 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 369 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF85729	2.8e-122	99.5	unnamed protein...	Homo sapiens
BAF84077	1.9e-120	99.7	unnamed protein...	Homo sapiens
XP_001105424	2.6e-118	97.8	putative MAPK a...	Macaca mulatta
EDL11428	1.3e-104	94.6	RIKEN cDNA 2400...	Mus musculus
EDL92509	2e-91	93.0	similar to RIKE...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005061 22 144 PF03398 Protein of unknown function DUF292

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005061	22	144	PF03398	Protein of unknown function DUF292

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TGGATGGATGGGACTCTTATG
Primer_r	: GTATCATCCAATCCCAAAGCC
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1190 bp
Genome contig ID	gi51511732f_70386946
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGCTCAGTAGCTGCTAATAAAGTTAAAGATCCTG
Flanking genome sequence (133463 - 133512)	----+--------+--------+--------+--------+----* TGTCCTGCTTTCTCTACTGTTTGGTCAGATGATGAAGTATAAATCTGGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	70486946	70520407	10	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0174

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information