HUGE

Gene/Protein Characteristic Table for KIAA0177

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01659
Accession No. :	D79999
Description :	Poly [ADP-ribose] polymerase 4.
HUGO Gene Name :
Clone Name :	ha02779s1 [Vector Info]
Flexi ORF Clone :	pF1KA0177
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha02779, former representative clones for KIAA0177 with ha02779s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 5367 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 187 bp

Genome contig ID gi51511729r_23793070
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CAACTAACAAGCAATAATAAAATGAAACTTAAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCAGTTTTCTGTGTCTCATTTTTTTTGTTGATTTTTTTATGTATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 23893070 23975919 33 99.3 Perfect prediction

ContigView(URL based/DAS) 13 f 24405137 24409126 2 97.0 Internal No-hit

Features of the protein sequence	Description

Length: 1725 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10299	100.0	poly [ADP-ribos...	synthetic construct
AAC62491	99.9	putative poly(A...	Homo sapiens
Q9UKK3	99.7	Poly [ADP-ribos...	Homo sapiens
AAD47250	99.4	vault protein; ...	Homo sapiens
EAX08336	99.4	poly (ADP-ribos...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001357 2 82 PF00533 BRCT

IPR001290 379 567 PF00644 Poly(ADP-ribose) polymerase

IPR013694 620 737 PF08487 Vault protein inter-alpha-trypsin

IPR002035 877 1044 PF00092 von Willebrand factor

HMMSmart IPR001357 4 85 SM00292 BRCT

IPR006587 608 736 SM00609 Vault protein inter-alpha-trypsin

IPR002035 875 1038 SM00327 von Willebrand factor

ProfileScan IPR001357 2 95 PS50172 BRCT

IPR004102 243 371 PS51060 Poly(ADP-ribose) polymerase

IPR012317 370 574 PS51059 PARP

IPR002035 877 1047 PS50234 von Willebrand factor

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001357	2	82	PF00533	BRCT
IPR001290	379	567	PF00644	Poly(ADP-ribose) polymerase
IPR013694	620	737	PF08487	Vault protein inter-alpha-trypsin
IPR002035	877	1044	PF00092	von Willebrand factor
HMMSmart	IPR001357	4	85	SM00292	BRCT
IPR006587	608	736	SM00609	Vault protein inter-alpha-trypsin
IPR002035	875	1038	SM00327	von Willebrand factor
ProfileScan	IPR001357	2	95	PS50172	BRCT
IPR004102	243	371	PS51060	Poly(ADP-ribose) polymerase
IPR012317	370	574	PS51059	PARP
IPR002035	877	1047	PS50234	von Willebrand factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ATAAGCCCCTGGACATCACAC
Primer_r	: TGTCTTCCTCCTCTGTGGCAC
PCR product length	: 102 (1.4k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	187 bp
Genome contig ID	gi51511729r_23793070
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAACTAACAAGCAATAATAAAATGAAACTTAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCAGTTTTCTGTGTCTCATTTTTTTTGTTGATTTTTTTATGTATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	23893070	23975919	33	99.3	Perfect prediction
ContigView(URL based/DAS)	13	f	24405137	24409126	2	97.0	Internal No-hit

Gene/Protein Characteristic Table for KIAA0177

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information