HUGE

Gene/Protein Characteristic Table for KIAA0188

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01962
Accession No. :	D80010
Description :	Lipin-1.
HUGO Gene Name :	lipin 1 (LPIN1)
Clone Name :	ha02734 [Vector Info]
Flexi ORF Clone :	pF1KA0188
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5307 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2606 bp

Genome contig ID gi89161199f_11723109
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGAAAATATTGCAATAAATGAGACCGATGAAAGAC
Flanking genome sequence
(161868 - 161917)
----+----*----+----*----+----*----+----*----+----*
TTCTCTGAAAATCAGGTGTGTGAATTTTAAATAGTTTTTGGTAAGTTACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 11804230 11884975 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 899 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX00918	100.0	lipin 1, isofor...	Homo sapiens
BAH13844	99.8	unnamed protein...	Homo sapiens
Q14693	100.0	Lipin-1.	Homo sapiens
AAH30537	99.9	Lipin 1 [Homo s...	Homo sapiens
ABM85602	99.8	lipin 1 [synthe...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87436	5.3e-88	51.6	KIAA0249

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007651 10 123 PF04571 Lipin

IPR013209 683 839 PF08235 LNS2

HMMSmart IPR013209 683 839 SM00775 LNS2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007651	10	123	PF04571	Lipin
IPR013209	683	839	PF08235	LNS2
HMMSmart	IPR013209	683	839	SM00775	LNS2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GCAAGGCTGGCATATTAACAC
Primer_r	: AGGGCAACTTTGAAATGTGTG
PCR product length	: 173 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2606 bp
Genome contig ID	gi89161199f_11723109
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGAAAATATTGCAATAAATGAGACCGATGAAAGAC
Flanking genome sequence (161868 - 161917)	----+--------+--------+--------+--------+----* TTCTCTGAAAATCAGGTGTGTGAATTTTAAATAGTTTTTGGTAAGTTACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	11804230	11884975	20	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0188

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information