HUGE

Gene/Protein Characteristic Table for KIAA0249

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01967
Accession No. :	D87436
Description :	Lipin-2.
HUGO Gene Name :	lipin 2 (LPIN2)
Clone Name :	ha07006 [Vector Info]
Flexi ORF Clone :	pF1KA0249
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6219 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3289 bp

Genome contig ID gi51511735r_2807000
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAACAAAATGTTACAACAATAAACGAACATAACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTGAATGCATTTGGCTCTTTTCTTCAGGGGACATTGAAACCATCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 r 2907000 3001945 20 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 902 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92539	100.0	Lipin-2.	Homo sapiens
XP_001146228	99.4	lipin 2 isoform...	Pan troglodytes
XP_512044	99.6	lipin 2 isoform...	Pan troglodytes
XP_001085817	98.6	lipin 2 isoform...	Macaca mulatta
XP_001085702	98.7	lipin 2 isoform...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D80010	1.1e-91	51.5	KIAA0188

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007651 7 120 PF04571 Lipin

IPR013209 691 847 PF08235 LNS2

HMMSmart IPR013209 691 847 SM00775 LNS2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007651	7	120	PF04571	Lipin
IPR013209	691	847	PF08235	LNS2
HMMSmart	IPR013209	691	847	SM00775	LNS2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTCCCGTGTTGTAGAGCTTCC
Primer_r	: CACTGCACCAAAATATTAGCC
PCR product length	: 305 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3289 bp
Genome contig ID	gi51511735r_2807000
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAACAAAATGTTACAACAATAAACGAACATAACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGAATGCATTTGGCTCTTTTCTTCAGGGGACATTGAAACCATCTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	r	2907000	3001945	20	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0249

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information