HUGE

Gene/Protein Characteristic Table for KIAA0191

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07406
Accession No. :	D83776
Description :	Zinc finger CCHC domain-containing protein 11.
HUGO Gene Name :	zinc finger, CCHC domain containing 11 (ZCCHC11)
Clone Name :	ha02719 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5203 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 650 bp

Genome contig ID gi89161185r_52561545
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
AGTACTTCTATTTTAAGTTAATAAATCTTTTTGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAGTTAAATTTGGTTAAACTGTTGTATAGATGATGGAAATATTACGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 52661545 52764158 29 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1516 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5TAX3	100.0	Zinc finger CCH...	Homo sapiens
AAI31735	99.9	Zinc finger, CC...	Homo sapiens
NP_001009882	99.7	zinc finger, CC...	Homo sapiens
XP_001111993	98.4	similar to zinc...	Macaca mulatta
XP_513410	98.1	zinc finger, CC...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051498	1.7e-53	45.3	KIAA1711

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002058 500 553 PF03828 PAP/25A-associated

IPR001878 785 802 PF00098 Zinc finger

IPR002934 848 937 PF01909 DNA polymerase

IPR002058 1056 1109 PF03828 PAP/25A-associated

IPR001878 1165 1182 PF00098 Zinc finger

IPR001878 1229 1246 PF00098 Zinc finger

HMMSmart IPR001878 786 802 SM00343 Zinc finger

IPR001878 1166 1182 SM00343 Zinc finger

IPR001878 1230 1246 SM00343 Zinc finger

ProfileScan IPR001878 787 802 PS50158 Zinc finger

IPR001878 1167 1182 PS50158 Zinc finger

IPR001878 1230 1246 PS50158 Zinc finger

ScanRegExp IPR007087 178 200 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002058	500	553	PF03828	PAP/25A-associated
IPR001878	785	802	PF00098	Zinc finger
IPR002934	848	937	PF01909	DNA polymerase
IPR002058	1056	1109	PF03828	PAP/25A-associated
IPR001878	1165	1182	PF00098	Zinc finger
IPR001878	1229	1246	PF00098	Zinc finger
HMMSmart	IPR001878	786	802	SM00343	Zinc finger
IPR001878	1166	1182	SM00343	Zinc finger
IPR001878	1230	1246	SM00343	Zinc finger
ProfileScan	IPR001878	787	802	PS50158	Zinc finger
IPR001878	1167	1182	PS50158	Zinc finger
IPR001878	1230	1246	PS50158	Zinc finger
ScanRegExp	IPR007087	178	200	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CACCAAAGTCACCTAATTCAG
Primer_r	: GTCCCTTTTCTGCTTCTGCTG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	650 bp
Genome contig ID	gi89161185r_52561545
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- AGTACTTCTATTTTAAGTTAATAAATCTTTTTGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAGTTAAATTTGGTTAAACTGTTGTATAGATGATGGAAATATTACGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	52661545	52764158	29	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0191

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information