HUGE

Gene/Protein Characteristic Table for KIAA1711

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00894
Accession No. :	AB051498
Description :	Zinc finger CCHC domain-containing protein 6.
HUGO Gene Name :	zinc finger, CCHC domain containing 6 (ZCCHC6)
Clone Name :	fj18750 [Vector Info]
Flexi ORF Clone :	pF1KSDA1711
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3992 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 718 bp

Genome contig ID gi89161216r_87992694
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATTTTCAAAGGAAAAATAAAATGAAAGTACTTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTTTATGATACTCAGAAATTAGGATGAAGAACTTTTAAAATTGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 88092694 88143678 19 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1090 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW62714	100.0	zinc finger, CC...	Homo sapiens
Q5VYS8	100.0	Zinc finger CCH...	Homo sapiens
CAI45944	99.7	hypothetical pr...	Homo sapiens
XP_001138296	99.5	hypothetical pr...	Pan troglodytes
XP_001138453	95.5	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D83776	2.7e-76	45.1	KIAA0191

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001878 1046 1055 PR00939 Zinc finger

IPR001878 1055 1063 PR00939 Zinc finger

HMMPfam IPR002058 145 198 PF03828 PAP/25A-associated

IPR001878 558 575 PF00098 Zinc finger

IPR002934 621 709 PF01909 DNA polymerase

IPR002058 828 881 PF03828 PAP/25A-associated

IPR001878 940 957 PF00098 Zinc finger

IPR001878 1046 1063 PF00098 Zinc finger

HMMSmart IPR001878 559 575 SM00343 Zinc finger

IPR001878 941 957 SM00343 Zinc finger

IPR001878 1047 1063 SM00343 Zinc finger

ProfileScan IPR001878 560 575 PS50158 Zinc finger

IPR001878 942 956 PS50158 Zinc finger

IPR001878 1047 1063 PS50158 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001878	1046	1055	PR00939	Zinc finger
IPR001878	1055	1063	PR00939	Zinc finger
HMMPfam	IPR002058	145	198	PF03828	PAP/25A-associated
IPR001878	558	575	PF00098	Zinc finger
IPR002934	621	709	PF01909	DNA polymerase
IPR002058	828	881	PF03828	PAP/25A-associated
IPR001878	940	957	PF00098	Zinc finger
IPR001878	1046	1063	PF00098	Zinc finger
HMMSmart	IPR001878	559	575	SM00343	Zinc finger
IPR001878	941	957	SM00343	Zinc finger
IPR001878	1047	1063	SM00343	Zinc finger
ProfileScan	IPR001878	560	575	PS50158	Zinc finger
IPR001878	942	956	PS50158	Zinc finger
IPR001878	1047	1063	PS50158	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAACTATGGACCGGTATTCAG

Primer_r
: TGCTTTCACACCAGGATTCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: CCR
Primer_f	: TAACTATGGACCGGTATTCAG
Primer_r	: TGCTTTCACACCAGGATTCAG
PCR product length	: 181 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	718 bp
Genome contig ID	gi89161216r_87992694
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATTTTCAAAGGAAAAATAAAATGAAAGTACTTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTTATGATACTCAGAAATTAGGATGAAGAACTTTTAAAATTGCTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	88092694	88143678	19	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1711

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information