HUGE |
Gene/Protein Characteristic Table for KIAA1711 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00894 |
---|---|
Accession No. : | AB051498 |
Description : | Zinc finger CCHC domain-containing protein 6. |
HUGO Gene Name : | zinc finger, CCHC domain containing 6 (ZCCHC6) |
Clone Name : | fj18750 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1711
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3992 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 718 bp Genome contig ID gi89161216r_87992694 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ATTTTCAAAGGAAAAATAAAATGAAAGTACTTTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTTTTTATGATACTCAGAAATTAGGATGAAGAACTTTTAAAATTGCTGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 88092694 88143678 19 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1090 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TAACTATGGACCGGTATTCAG | |
: TGCTTTCACACCAGGATTCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: CCR | |
: TAACTATGGACCGGTATTCAG | |
: TGCTTTCACACCAGGATTCAG | |
: 181 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |