HUGE |
Gene/Protein Characteristic Table for KIAA0212 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00461 |
---|---|
Accession No. : | D86967 |
Description : | ER degradation-enhancing alpha-mannosidase-like 1. |
HUGO Gene Name : | ER degradation enhancer, mannosidase alpha-like 1 (EDEM1) |
Clone Name : | ha02602 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0212
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6072 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4040 bp Genome contig ID gi89161205f_5104433 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
TATGAGTAATTTTTATTAAAAGATTTCTTTTTTTGFlanking genome sequence
(132211 - 132260) ----+----*----+----*----+----*----+----*----+----*
AGTTGTCATCTTGTTTCTTTTTTACATTCTCATGTACATTACATTACATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 5204433 5236642 12 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 666 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 3 |
: Genebridge 4 | |
: TACCCTCTTCCTTCTTTCTGC | |
: TTTCCGTAAGTTTTCCCAGAG | |
: 171 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |