HUGE |
Gene/Protein Characteristic Table for KIAA0219 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05284 |
---|---|
Accession No. : | D86973 |
Description : | GCN1-like protein 1. |
HUGO Gene Name : | GCN1 general control of amino-acid synthesis 1-like 1 (yeast) (GCN1L1) |
Clone Name : | ha04759s1 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha04759, former representative clones for KIAA0219 with ha04759s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8608 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 579 bp Genome contig ID gi89161190r_118949457 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AGAGGAATGTTTAATAAAGGCTTTGATTTAATCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GATATAAACAGATTTTTAAAAATCTCCACCCATTAAACATGAAGCTTCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 119049457 119116896 58 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2675 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 12 |
: Genebridge 4 | |
: GTGGGTTCCTCTTCTCCTGTG | |
: AAAAGCCAAGCCAGACACACC | |
: 127 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |