HUGE

Gene/Protein Characteristic Table for KIAA0220

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05585
Accession No. :	D86974
Description :	nuclear pore complex interacting protein pseudogene (LOC440353) on chromosome 16.
HUGO Gene Name :
Clone Name :	ha04626 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5471 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 128 bp

Genome contig ID gi51511732r_21220978
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAAACTAACAAAGAATAAATAAATAATATAAAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATAAATACTGCAGTCCTTATGTTATTGCTTTGTTTCGATATCTGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 21320978 21377463 24 99.3 Terminal No-hit

ContigView(URL based/DAS) 16 f 22399084 22455335 25 99.1 Terminal No-hit

ContigView(URL based/DAS) 16 r 21753412 21809706 26 98.8 Terminal No-hit

ContigView(URL based/DAS) 16 r 29402383 29459387 25 98.3 Both No-hit

ContigView(URL based/DAS) 16 r 29300140 29357622 27 97.2 Both No-hit

Features of the protein sequence	Description

Length: 553 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG61851	100.0	unnamed protein...	Homo sapiens
Q5BKU6	100.0	Putative unchar...	Homo sapiens
AAH90929	100.0	LOC641298 prote...	Homo sapiens
XP_001151793	96.0	similar to PI-3...	Pan troglodytes
XP_001151857	96.0	similar to PI-3...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CGGAGGTTGAGCTGAGAAGAG
Primer_r	: TGTTAGTTTTTGGAGTGTGGG
PCR product length	: 118 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	128 bp
Genome contig ID	gi51511732r_21220978
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAAACTAACAAAGAATAAATAAATAATATAAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATAAATACTGCAGTCCTTATGTTATTGCTTTGTTTCGATATCTGGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	21320978	21377463	24	99.3	Terminal No-hit
ContigView(URL based/DAS)	16	f	22399084	22455335	25	99.1	Terminal No-hit
ContigView(URL based/DAS)	16	r	21753412	21809706	26	98.8	Terminal No-hit
ContigView(URL based/DAS)	16	r	29402383	29459387	25	98.3	Both No-hit
ContigView(URL based/DAS)	16	r	29300140	29357622	27	97.2	Both No-hit

Gene/Protein Characteristic Table for KIAA0220

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information