HUGE |
Gene/Protein Characteristic Table for KIAA0222 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00467 |
---|---|
Accession No. : | D86975 |
Description : | Zinc finger protein 516. |
HUGO Gene Name : | zinc finger protein 516 (ZNF516) |
Clone Name : | ha02586 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0222
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6033 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2223 bp Genome contig ID gi51511735r_72101218 PolyA signal sequence
(ATTAAA,-28) +----*----+----*----+----*----+----
TTTAGTTATTAAAAAGAAATTCTGTACCCAAAGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACACGAAAGTGTAGTCTACATTTTTACTGTTTCAGAAGCGGCATGGAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 r 72201218 72336134 7 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1204 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 18 |
: Genebridge 4 | |
: CCACCTAAGAAATCAGAAGAC | |
: TTCCTAACAGTCACCATTCAC | |
: 130 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |