HUGE

Gene/Protein Characteristic Table for KIAA0228

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04144
Accession No. :	D86981
Description :	Amyloid protein-binding protein 2.
HUGO Gene Name :	amyloid beta precursor protein (cytoplasmic tail) binding protein 2 (APPBP2)
Clone Name :	ha04738 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6465 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4419 bp

Genome contig ID gi51511734r_55775302
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATGAATTATTGACCTAATAAATATAGTGTTCCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCATAGTGTATCTGTTTCCAATTTGGTTTTGATTGCTTTTGGTTGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 55875302 55958362 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 681 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001136833	99.7	amyloid beta pr...	Pan troglodytes
EDL15760	90.9	amyloid beta pr...	Mus musculus
Q92624	100.0	Amyloid protein...	Homo sapiens
XP_001918329	99.8	amyloid beta pr...	Equus caballus
Q9DAX9	99.1	Amyloid protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082531	0.00039	25.2	KIAA2000

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR013026 342 375 SM00028 Tetratricopeptide region

IPR013026 525 558 SM00028 Tetratricopeptide region

IPR013026 567 601 SM00028 Tetratricopeptide region

ProfileScan IPR013026 384 417 PS50005 Tetratricopeptide region

IPR013026 525 558 PS50005 Tetratricopeptide region

IPR013026 525 558 PS50293 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR013026	342	375	SM00028	Tetratricopeptide region
IPR013026	525	558	SM00028	Tetratricopeptide region
IPR013026	567	601	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	384	417	PS50005	Tetratricopeptide region
IPR013026	525	558	PS50005	Tetratricopeptide region
IPR013026	525	558	PS50293	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGATCAGCGCTGGGACGGAAC
Primer_r	: GCAGGCCCGAGTAAAAAGTGG
PCR product length	: 103 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4419 bp
Genome contig ID	gi51511734r_55775302
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGAATTATTGACCTAATAAATATAGTGTTCCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCATAGTGTATCTGTTTCCAATTTGGTTTTGATTGCTTTTGGTTGGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	55875302	55958362	13	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0228

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information