HUGE |
Gene/Protein Characteristic Table for KIAA2000 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06179 |
---|---|
Accession No. : | AB082531 |
Description : | Nephrocystin-3. |
HUGO Gene Name : | nephronophthisis 3 (adolescent) (NPHP3) |
Clone Name : | bf00135 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7784 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3704 bp Genome contig ID gi89161205r_133659676 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
TGAACATTAGGAATTAAAGGCTATATCTGGTCCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACAATTTTGTAATTTGTTTCTCTGTCTGAGGAAAGCTGGCTGGATTGGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 133759676 133923993 45 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 699 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTAAACAAGACCAGCAAAGCC | |
: CTGCCCAAATCCTTAGTCTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |