| HUGE |
Gene/Protein Characteristic Table for KIAA1785 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00917 |
|---|---|
| Accession No. : | AB058688 |
| Description : | feminization 1 homolog a. |
| HUGO Gene Name : | fem-1 homolog c (C. elegans) (FEM1C) |
| Clone Name : | fh12727 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1785
|
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5339 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3395 bp Genome contig ID gi51511721r_114784507 PolyA signal sequence
(AATAAA,-20)
TTCATTGTAAGGTTTAATAAAATTAAATTTGCACCFlanking genome sequence
(100000 - 99951)
AAATTTAAGTGTATTCTTATTAACTCAATACTTGATTGGTATTATCCTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 114884507 114907179 2 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 617 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AACATGAGGTACAGTGATAGG | |
| : TAGTGCCTGCATTCTCATCTC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 5 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
