HUGE

Gene/Protein Characteristic Table for KIAA1728

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07057
Accession No. :	AB051515
Description :	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1.
HUGO Gene Name :	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (TANC1)
Clone Name :	pg00239 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 6585 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1648 bp

Genome contig ID gi89161199f_159628038
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGTACTTTTCCATATGGAATAAAGACTATTAATAG
Flanking genome sequence
(169378 - 169427)
----+----*----+----*----+----*----+----*----+----*
AATGTGTTTTGCACTAAATGAGTCAATGGATAAGTAGAGAACAGCCTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 159715281 159797414 21 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX11418	99.9	tetratricopepti...	Homo sapiens
Q9C0D5	99.9	Protein TANC1; ...	Homo sapiens
XP_001093114	97.5	similar to TPR ...	Macaca mulatta
XP_001093218	97.5	similar to TPR ...	Macaca mulatta
XP_001492440	91.9	tetratricopepti...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046856	9.4e-172	52.4	KIAA1636
AB033049	5e-15	25.9	KIAA1223
AB033076	2.2e-08	30.0	KIAA1250
AB002377	9.8e-07	33.0	KIAA0379
AB037755	5.5e-06	29.7	KIAA1334

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 928 940 PR01415 Ankyrin

IPR002110 940 952 PR01415 Ankyrin

HMMPfam IPR002110 685 714 PF00023 Ankyrin

IPR002110 726 749 PF00023 Ankyrin

IPR002110 750 782 PF00023 Ankyrin

IPR002110 783 806 PF00023 Ankyrin

IPR002110 827 859 PF00023 Ankyrin

IPR002110 861 893 PF00023 Ankyrin

IPR002110 894 926 PF00023 Ankyrin

IPR002110 927 959 PF00023 Ankyrin

IPR002110 960 992 PF00023 Ankyrin

IPR002110 993 1025 PF00023 Ankyrin

IPR002110 1026 1058 PF00023 Ankyrin

IPR001440 1119 1152 PF00515 Tetratricopeptide TPR_1

IPR013105 1153 1186 PF07719 Tetratricopeptide TPR_2

HMMSmart IPR002110 679 711 SM00248 Ankyrin

IPR002110 715 746 SM00248 Ankyrin

IPR002110 750 779 SM00248 Ankyrin

IPR002110 823 852 SM00248 Ankyrin

IPR002110 861 890 SM00248 Ankyrin

IPR002110 894 923 SM00248 Ankyrin

IPR002110 927 956 SM00248 Ankyrin

IPR002110 960 989 SM00248 Ankyrin

IPR002110 993 1022 SM00248 Ankyrin

IPR002110 1026 1055 SM00248 Ankyrin

IPR013026 1072 1105 SM00028 Tetratricopeptide region

IPR013026 1119 1152 SM00028 Tetratricopeptide region

IPR013026 1153 1186 SM00028 Tetratricopeptide region

ProfileScan IPR002110 679 1053 PS50297 Ankyrin

IPR002110 750 782 PS50088 Ankyrin

IPR002110 861 893 PS50088 Ankyrin

IPR002110 894 926 PS50088 Ankyrin

IPR002110 927 959 PS50088 Ankyrin

IPR002110 960 992 PS50088 Ankyrin

IPR002110 993 1025 PS50088 Ankyrin

IPR013026 1072 1105 PS50005 Tetratricopeptide region

IPR013026 1072 1186 PS50293 Tetratricopeptide region

IPR013026 1119 1152 PS50005 Tetratricopeptide region

IPR013026 1153 1186 PS50005 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	928	940	PR01415	Ankyrin
IPR002110	940	952	PR01415	Ankyrin
HMMPfam	IPR002110	685	714	PF00023	Ankyrin
IPR002110	726	749	PF00023	Ankyrin
IPR002110	750	782	PF00023	Ankyrin
IPR002110	783	806	PF00023	Ankyrin
IPR002110	827	859	PF00023	Ankyrin
IPR002110	861	893	PF00023	Ankyrin
IPR002110	894	926	PF00023	Ankyrin
IPR002110	927	959	PF00023	Ankyrin
IPR002110	960	992	PF00023	Ankyrin
IPR002110	993	1025	PF00023	Ankyrin
IPR002110	1026	1058	PF00023	Ankyrin
IPR001440	1119	1152	PF00515	Tetratricopeptide TPR_1
IPR013105	1153	1186	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR002110	679	711	SM00248	Ankyrin
IPR002110	715	746	SM00248	Ankyrin
IPR002110	750	779	SM00248	Ankyrin
IPR002110	823	852	SM00248	Ankyrin
IPR002110	861	890	SM00248	Ankyrin
IPR002110	894	923	SM00248	Ankyrin
IPR002110	927	956	SM00248	Ankyrin
IPR002110	960	989	SM00248	Ankyrin
IPR002110	993	1022	SM00248	Ankyrin
IPR002110	1026	1055	SM00248	Ankyrin
IPR013026	1072	1105	SM00028	Tetratricopeptide region
IPR013026	1119	1152	SM00028	Tetratricopeptide region
IPR013026	1153	1186	SM00028	Tetratricopeptide region
ProfileScan	IPR002110	679	1053	PS50297	Ankyrin
IPR002110	750	782	PS50088	Ankyrin
IPR002110	861	893	PS50088	Ankyrin
IPR002110	894	926	PS50088	Ankyrin
IPR002110	927	959	PS50088	Ankyrin
IPR002110	960	992	PS50088	Ankyrin
IPR002110	993	1025	PS50088	Ankyrin
IPR013026	1072	1105	PS50005	Tetratricopeptide region
IPR013026	1072	1186	PS50293	Tetratricopeptide region
IPR013026	1119	1152	PS50005	Tetratricopeptide region
IPR013026	1153	1186	PS50005	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCATCTGTCCCTTCCTCATAC

Primer_r
: CTGGCTGGTTTTCACGATCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: CCR
Primer_f	: TCATCTGTCCCTTCCTCATAC
Primer_r	: CTGGCTGGTTTTCACGATCTG
PCR product length	: 174 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1648 bp
Genome contig ID	gi89161199f_159628038
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTACTTTTCCATATGGAATAAAGACTATTAATAG
Flanking genome sequence (169378 - 169427)	----+--------+--------+--------+--------+----* AATGTGTTTTGCACTAAATGAGTCAATGGATAAGTAGAGAACAGCCTGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	159715281	159797414	21	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1728

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information