HUGE |
Gene/Protein Characteristic Table for KIAA1728 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07057 |
---|---|
Accession No. : | AB051515 |
Description : | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1. |
HUGO Gene Name : | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (TANC1) |
Clone Name : | pg00239 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6585 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1648 bp Genome contig ID gi89161199f_159628038 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGTACTTTTCCATATGGAATAAAGACTATTAATAGFlanking genome sequence
(169378 - 169427) ----+----*----+----*----+----*----+----*----+----*
AATGTGTTTTGCACTAAATGAGTCAATGGATAAGTAGAGAACAGCCTGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 159715281 159797414 21 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1644 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCATCTGTCCCTTCCTCATAC | |
: CTGGCTGGTTTTCACGATCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: CCR | |
: TCATCTGTCCCTTCCTCATAC | |
: CTGGCTGGTTTTCACGATCTG | |
: 174 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |