HUGE |
Gene/Protein Characteristic Table for KIAA1250 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05646 |
---|---|
Accession No. : | AB033076 |
Description : | kinase D-interacting substrate of 220 kDa. |
HUGO Gene Name : | |
Clone Name : | pf01137 [Vector Info] |
Source : | Human brain (hippocampus) |
Note : | We replaced hh06271, former representative clones for KIAA1250 with pf01137. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7264 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1791 bp Genome contig ID gi89161199r_8686511 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
AAATAGATTTAGAAAACAATAAAAAATTGCATGCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTCTGACTCATGAATTTTTATTCACTATGATGATTCACATTTTGATTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 8786511 8895181 30 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1777 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGCCGAGTTAAGAGAATGGTC | |
: CCATCTACCGTCCTAACTGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |